Mutagenetix > Incidental Mutation

Incidental Mutation 'R4017:Klhl10'

311998

Institutional Source

Beutler Lab

Gene Symbol

Klhl10

Ensembl Gene

ENSMUSG00000001558

Gene Name

kelch-like 10

Synonyms

4921517C11Rik

MMRRC Submission

041611-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.387) question?

Stock #

R4017 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

100332743-100347848 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 100336500 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Isoleucine at position 162 (M162I)

Ref Sequence

ENSEMBL: ENSMUSP00000103018 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001599] [ENSMUST00000092688] [ENSMUST00000092689] [ENSMUST00000107395] [ENSMUST00000107397] [ENSMUST00000107398] [ENSMUST00000107399]

AlphaFold

Q9D5V2

Predicted Effect

probably benign
Transcript: ENSMUST00000001599
AA Change: M162I

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000001599
Gene: ENSMUSG00000001558
AA Change: M162I

Domain	Start	End	E-Value	Type
BTB	39	136	1.09e-30	SMART
BACK	141	244	6.58e-38	SMART
Kelch	292	339	2.99e-7	SMART
Kelch	340	386	2.66e-13	SMART
Kelch	387	433	1.7e-11	SMART
Kelch	434	480	1.47e-15	SMART
Kelch	481	527	2.2e-14	SMART
Kelch	528	574	3.6e-10	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000092688

SMART Domains

Protein: ENSMUSP00000090360
Gene: ENSMUSG00000017176

Domain	Start	End	E-Value	Type
Pfam:UMPH-1	44	289	6.2e-126	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000092689

SMART Domains

Protein: ENSMUSP00000090361
Gene: ENSMUSG00000017176

Domain	Start	End	E-Value	Type
Pfam:UMPH-1	1	246	1.2e-123	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000107395
AA Change: M162I

PolyPhen 2 Score 0.157 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000103018
Gene: ENSMUSG00000001558
AA Change: M162I

Domain	Start	End	E-Value	Type
BTB	39	136	1.09e-30	SMART
BACK	141	239	5.74e-29	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000107397

SMART Domains

Protein: ENSMUSP00000103020
Gene: ENSMUSG00000017176

Domain	Start	End	E-Value	Type
Pfam:UMPH-1	36	281	1.9e-123	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000107398

SMART Domains

Protein: ENSMUSP00000103021
Gene: ENSMUSG00000017176

Domain	Start	End	E-Value	Type
Pfam:UMPH-1	44	261	3.5e-108	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000107399

SMART Domains

Protein: ENSMUSP00000103022
Gene: ENSMUSG00000017176

Domain	Start	End	E-Value	Type
Pfam:UMPH-1	44	261	3.5e-108	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140034

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140381

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130666

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183660

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135557

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155025

Meta Mutation Damage Score

0.0652

Coding Region Coverage

1x: 99.3%
3x: 98.5%
10x: 96.9%
20x: 93.8%

Validation Efficiency

97% (36/37)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the kelch repeat-containing family, and contains an N-terminal BTB/POZ domain a BACK domain and six C-terminal kelch repeats. Kelch domains are thought to form a four stranded beta-sheet blade structure that can fold into a beta-propeller domain when multiple kelch repeats are found together. Mutations in this gene have been associated with oligozoospermia in some infertile males. [provided by RefSeq, Jul 2016]
PHENOTYPE: Disruption of one allele results in haploinsufficient male infertility in which heterozygous and chimeric males have a block in spermiogenesis. Female chimeras are fertile. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actn3	G	T	19: 4,917,574 (GRCm39)	T423N	possibly damaging	Het
Apold1	A	G	6: 134,960,869 (GRCm39)	I108V	probably benign	Het
Arhgap21	G	T	2: 20,896,915 (GRCm39)	F121L	probably benign	Het
BC004004	T	C	17: 29,517,706 (GRCm39)	S307P	probably damaging	Het
Cpeb4	A	G	11: 31,874,671 (GRCm39)	D484G	probably damaging	Het
Dctpp1	G	A	7: 126,856,285 (GRCm39)	R146C	probably damaging	Het
Dnm2	A	G	9: 21,405,900 (GRCm39)	Y553C	probably damaging	Het
Dync1h1	G	T	12: 110,609,624 (GRCm39)	R2802I	probably damaging	Het
Eif2a	T	A	3: 58,452,776 (GRCm39)	M209K	probably damaging	Het
Epb41	A	T	4: 131,709,756 (GRCm39)		probably benign	Het
Fnip1	A	G	11: 54,400,813 (GRCm39)	K1071E	probably benign	Het
Igf2bp2	T	C	16: 21,882,426 (GRCm39)	N425S	probably damaging	Het
Kdm5a	T	A	6: 120,371,067 (GRCm39)	Y504N	probably damaging	Het
Kif1a	T	C	1: 93,004,014 (GRCm39)	D156G	probably damaging	Het
Lrp1b	A	G	2: 40,692,996 (GRCm39)	F3401L	possibly damaging	Het
Lrp6	G	T	6: 134,497,513 (GRCm39)	R165S	probably damaging	Het
Muc5b	G	A	7: 141,417,367 (GRCm39)	V3438M	probably benign	Het
Myo3a	A	G	2: 22,468,182 (GRCm39)	R479G	possibly damaging	Het
Npr1	T	C	3: 90,363,539 (GRCm39)	E828G	probably damaging	Het
Obscn	A	G	11: 59,023,448 (GRCm39)	F643S	probably damaging	Het
Or11h23	A	T	14: 50,948,333 (GRCm39)	D182V	probably benign	Het
Or12e1	A	G	2: 87,022,846 (GRCm39)	S272G	probably benign	Het
Pcdhga8	T	C	18: 37,948,791 (GRCm39)	V69A	probably damaging	Het
Ppp6r1	C	A	7: 4,636,743 (GRCm39)	C688F	probably benign	Het
Ptch1	T	G	13: 63,672,773 (GRCm39)	E944A	probably benign	Het
Rnf157	A	T	11: 116,250,067 (GRCm39)		probably null	Het
Saxo1	A	T	4: 86,476,233 (GRCm39)	I7N	possibly damaging	Het
Scn7a	A	T	2: 66,572,329 (GRCm39)	I214N	probably damaging	Het
Setx	GTGGCT	GT	2: 29,044,073 (GRCm39)	1814	probably null	Het
Suz12	G	T	11: 79,904,292 (GRCm39)	V211F	probably damaging	Het
Trim9	G	A	12: 70,393,126 (GRCm39)	H273Y	probably damaging	Het
Uggt2	T	C	14: 119,263,845 (GRCm39)	N1062D	possibly damaging	Het
Wdr70	A	T	15: 8,108,698 (GRCm39)	C149*	probably null	Het
Zfp940	T	C	7: 29,545,359 (GRCm39)	I183V	probably benign	Het

Other mutations in Klhl10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00473:Klhl10	APN	11	100,347,240 (GRCm39)	missense	probably damaging	1.00
IGL00540:Klhl10	APN	11	100,336,244 (GRCm39)	missense	probably benign	0.35
IGL00988:Klhl10	APN	11	100,347,110 (GRCm39)	missense	possibly damaging	0.82
IGL02078:Klhl10	APN	11	100,336,577 (GRCm39)	missense	probably benign	0.19
IGL03153:Klhl10	APN	11	100,347,758 (GRCm39)	missense	probably benign
R0110:Klhl10	UTSW	11	100,347,758 (GRCm39)	missense	probably benign	0.00
R0532:Klhl10	UTSW	11	100,337,937 (GRCm39)	unclassified	probably benign
R1772:Klhl10	UTSW	11	100,333,022 (GRCm39)	missense	probably benign	0.15
R4508:Klhl10	UTSW	11	100,333,002 (GRCm39)	missense	possibly damaging	0.87
R4772:Klhl10	UTSW	11	100,338,557 (GRCm39)	missense	probably benign	0.23
R4831:Klhl10	UTSW	11	100,336,669 (GRCm39)	missense	probably benign	0.04
R5267:Klhl10	UTSW	11	100,338,047 (GRCm39)	missense	probably benign	0.26
R7086:Klhl10	UTSW	11	100,347,768 (GRCm39)	missense	probably benign	0.02
R8223:Klhl10	UTSW	11	100,338,227 (GRCm39)	missense	probably damaging	1.00
R9076:Klhl10	UTSW	11	100,337,962 (GRCm39)	missense	possibly damaging	0.52
R9288:Klhl10	UTSW	11	100,347,719 (GRCm39)	missense	probably benign
R9324:Klhl10	UTSW	11	100,338,481 (GRCm39)	missense	probably benign	0.13
R9744:Klhl10	UTSW	11	100,336,396 (GRCm39)	missense	probably damaging	1.00
RF020:Klhl10	UTSW	11	100,332,896 (GRCm39)	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CTGACAATGTGGAGAAGCTGC -3'
(R):5'- AGCAAGAGACCTATTTTGTGGC -3'

Sequencing Primer
(F):5'- ATGTGGAGAAGCTGCTGGCC -3'
(R):5'- CAAGAGACCTATTTTGTGGCTCTTG -3'

Posted On

2015-04-29