Incidental Mutation 'R4017:Rnf157'
ID311999
Institutional Source Beutler Lab
Gene Symbol Rnf157
Ensembl Gene ENSMUSG00000052949
Gene Namering finger protein 157
SynonymsA130073L17Rik, 2610036E23Rik
MMRRC Submission 041611-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4017 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location116336353-116413032 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 116359241 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000102006 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100202] [ENSMUST00000106398] [ENSMUST00000106398]
Predicted Effect probably null
Transcript: ENSMUST00000100202
SMART Domains Protein: ENSMUSP00000097776
Gene: ENSMUSG00000052949

DomainStartEndE-ValueType
RING 277 315 5.64e-4 SMART
low complexity region 345 358 N/A INTRINSIC
low complexity region 427 444 N/A INTRINSIC
low complexity region 446 457 N/A INTRINSIC
low complexity region 552 562 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106398
SMART Domains Protein: ENSMUSP00000102006
Gene: ENSMUSG00000052949

DomainStartEndE-ValueType
RING 277 315 5.64e-4 SMART
low complexity region 345 358 N/A INTRINSIC
low complexity region 427 444 N/A INTRINSIC
low complexity region 446 457 N/A INTRINSIC
low complexity region 552 562 N/A INTRINSIC
low complexity region 563 574 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106398
SMART Domains Protein: ENSMUSP00000102006
Gene: ENSMUSG00000052949

DomainStartEndE-ValueType
RING 277 315 5.64e-4 SMART
low complexity region 345 358 N/A INTRINSIC
low complexity region 427 444 N/A INTRINSIC
low complexity region 446 457 N/A INTRINSIC
low complexity region 552 562 N/A INTRINSIC
low complexity region 563 574 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129202
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137083
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141229
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142758
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148763
Predicted Effect probably benign
Transcript: ENSMUST00000149147
SMART Domains Protein: ENSMUSP00000122483
Gene: ENSMUSG00000052949

DomainStartEndE-ValueType
RING 102 140 5.64e-4 SMART
low complexity region 170 183 N/A INTRINSIC
low complexity region 252 269 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 377 387 N/A INTRINSIC
Meta Mutation Damage Score 0.9496 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency 97% (36/37)
MGI Phenotype PHENOTYPE: The gene supports neuronal survival and dendrite growth and maintenance and knockdown with siRNA induces apoptosis in neuronal tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn3 G T 19: 4,867,546 T423N possibly damaging Het
Apold1 A G 6: 134,983,906 I108V probably benign Het
Arhgap21 G T 2: 20,892,104 F121L probably benign Het
BC004004 T C 17: 29,298,732 S307P probably damaging Het
Cpeb4 A G 11: 31,924,671 D484G probably damaging Het
Dctpp1 G A 7: 127,257,113 R146C probably damaging Het
Dnm2 A G 9: 21,494,604 Y553C probably damaging Het
Dync1h1 G T 12: 110,643,190 R2802I probably damaging Het
Eif2a T A 3: 58,545,355 M209K probably damaging Het
Epb41 A T 4: 131,982,445 probably benign Het
Fnip1 A G 11: 54,509,987 K1071E probably benign Het
Igf2bp2 T C 16: 22,063,676 N425S probably damaging Het
Kdm5a T A 6: 120,394,106 Y504N probably damaging Het
Kif1a T C 1: 93,076,292 D156G probably damaging Het
Klhl10 G A 11: 100,445,674 M162I probably benign Het
Lrp1b A G 2: 40,802,984 F3401L possibly damaging Het
Lrp6 G T 6: 134,520,550 R165S probably damaging Het
Muc5b G A 7: 141,863,630 V3438M probably benign Het
Myo3a A G 2: 22,578,170 R479G possibly damaging Het
Npr1 T C 3: 90,456,232 E828G probably damaging Het
Obscn A G 11: 59,132,622 F643S probably damaging Het
Olfr1112 A G 2: 87,192,502 S272G probably benign Het
Olfr748 A T 14: 50,710,876 D182V probably benign Het
Pcdhga8 T C 18: 37,815,738 V69A probably damaging Het
Ppp6r1 C A 7: 4,633,744 C688F probably benign Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Saxo1 A T 4: 86,557,996 I7N possibly damaging Het
Scn7a A T 2: 66,741,985 I214N probably damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Suz12 G T 11: 80,013,466 V211F probably damaging Het
Trim9 G A 12: 70,346,352 H273Y probably damaging Het
Uggt2 T C 14: 119,026,433 N1062D possibly damaging Het
Wdr70 A T 15: 8,079,214 C149* probably null Het
Zfp940 T C 7: 29,845,934 I183V probably benign Het
Other mutations in Rnf157
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00487:Rnf157 APN 11 116362355 missense probably benign 0.20
IGL01146:Rnf157 APN 11 116350086 missense probably benign 0.00
IGL01955:Rnf157 APN 11 116359896 missense probably damaging 0.96
IGL02010:Rnf157 APN 11 116396226 missense probably damaging 1.00
IGL02194:Rnf157 APN 11 116347032 critical splice donor site probably null
IGL03092:Rnf157 APN 11 116347969 critical splice acceptor site probably null
PIT4362001:Rnf157 UTSW 11 116360317 missense probably damaging 1.00
R0022:Rnf157 UTSW 11 116349450 unclassified probably benign
R0022:Rnf157 UTSW 11 116349450 unclassified probably benign
R0036:Rnf157 UTSW 11 116396302 missense probably damaging 1.00
R0164:Rnf157 UTSW 11 116354810 splice site probably benign
R1476:Rnf157 UTSW 11 116354759 missense probably damaging 1.00
R1509:Rnf157 UTSW 11 116347095 missense probably benign
R1544:Rnf157 UTSW 11 116354362 splice site probably null
R1654:Rnf157 UTSW 11 116358715 missense probably damaging 1.00
R1820:Rnf157 UTSW 11 116354651 missense probably damaging 1.00
R2133:Rnf157 UTSW 11 116358694 missense possibly damaging 0.93
R4590:Rnf157 UTSW 11 116359272 missense probably damaging 1.00
R4872:Rnf157 UTSW 11 116355472 missense possibly damaging 0.93
R4891:Rnf157 UTSW 11 116358670 missense probably damaging 1.00
R5608:Rnf157 UTSW 11 116396320 splice site probably null
R5870:Rnf157 UTSW 11 116347074 missense probably benign
R7171:Rnf157 UTSW 11 116362373 missense possibly damaging 0.83
R7376:Rnf157 UTSW 11 116360366 missense probably benign 0.35
X0020:Rnf157 UTSW 11 116360308 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGTGGCCAAAATACTCTGAAAG -3'
(R):5'- CTTCTGAGGGACTGATGAGC -3'

Sequencing Primer
(F):5'- GAGACAGCCTCAGTCCTCTC -3'
(R):5'- GGACTGATGAGCATGCACACAC -3'
Posted On2015-04-29