Mutagenetix > Incidental Mutations

Incidental Mutation 'R4017:Uggt2'

312004

Institutional Source

Beutler Lab

Gene Symbol

Uggt2

Ensembl Gene

ENSMUSG00000042104

Gene Name

UDP-glucose glycoprotein glucosyltransferase 2

Synonyms

3110001A05Rik, 3110027P15Rik, 1810064L21Rik, Ugcgl2, A230065J02Rik

MMRRC Submission

041611-MU

Accession Numbers

NCBI RefSeq: NM_001081252.2; MGI:1913685

Is this an essential gene?

Probably non essential (E-score: 0.162) question?

Stock #

R4017 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

118985039-119099430 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 119026433 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 1062 (N1062D)

Ref Sequence

ENSEMBL: ENSMUSP00000121249 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000127153] [ENSMUST00000156203]

Predicted Effect

probably benign
Transcript: ENSMUST00000127153

SMART Domains

Protein: ENSMUSP00000117738
Gene: ENSMUSG00000042104

Domain	Start	End	E-Value	Type
low complexity region	327	334	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000153693
AA Change: N100D

SMART Domains

Protein: ENSMUSP00000123327
Gene: ENSMUSG00000042104
AA Change: N100D

Domain	Start	End	E-Value	Type
Pfam:UDP-g_GGTase	1	106	3.3e-40	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000156203
AA Change: N1062D

PolyPhen 2 Score 0.473 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000121249
Gene: ENSMUSG00000042104
AA Change: N1062D

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:UDP-g_GGTase	23	1189	N/A	PFAM
SCOP:d1ga8a_	1219	1485	9e-44	SMART
Blast:BROMO	1377	1427	4e-16	BLAST

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.3%
3x: 98.5%
10x: 96.9%
20x: 93.8%

Validation Efficiency

97% (36/37)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UDP-glucose:glycoprotein glucosyltransferase (UGT) is a soluble protein of the endoplasmic reticulum (ER) that selectively reglucosylates unfolded glycoproteins, thus providing quality control for protein transport out of the ER.[supplied by OMIM, Oct 2009]

Allele List at MGI

All alleles(5) : Targeted(2) Gene trapped(3)

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actn3	G	T	19: 4,867,546	T423N	possibly damaging	Het
Apold1	A	G	6: 134,983,906	I108V	probably benign	Het
Arhgap21	G	T	2: 20,892,104	F121L	probably benign	Het
BC004004	T	C	17: 29,298,732	S307P	probably damaging	Het
Cpeb4	A	G	11: 31,924,671	D484G	probably damaging	Het
Dctpp1	G	A	7: 127,257,113	R146C	probably damaging	Het
Dnm2	A	G	9: 21,494,604	Y553C	probably damaging	Het
Dync1h1	G	T	12: 110,643,190	R2802I	probably damaging	Het
Eif2a	T	A	3: 58,545,355	M209K	probably damaging	Het
Epb41	A	T	4: 131,982,445		probably benign	Het
Fnip1	A	G	11: 54,509,987	K1071E	probably benign	Het
Igf2bp2	T	C	16: 22,063,676	N425S	probably damaging	Het
Kdm5a	T	A	6: 120,394,106	Y504N	probably damaging	Het
Kif1a	T	C	1: 93,076,292	D156G	probably damaging	Het
Klhl10	G	A	11: 100,445,674	M162I	probably benign	Het
Lrp1b	A	G	2: 40,802,984	F3401L	possibly damaging	Het
Lrp6	G	T	6: 134,520,550	R165S	probably damaging	Het
Muc5b	G	A	7: 141,863,630	V3438M	probably benign	Het
Myo3a	A	G	2: 22,578,170	R479G	possibly damaging	Het
Npr1	T	C	3: 90,456,232	E828G	probably damaging	Het
Obscn	A	G	11: 59,132,622	F643S	probably damaging	Het
Olfr1112	A	G	2: 87,192,502	S272G	probably benign	Het
Olfr748	A	T	14: 50,710,876	D182V	probably benign	Het
Pcdhga8	T	C	18: 37,815,738	V69A	probably damaging	Het
Ppp6r1	C	A	7: 4,633,744	C688F	probably benign	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Rnf157	A	T	11: 116,359,241		probably null	Het
Saxo1	A	T	4: 86,557,996	I7N	possibly damaging	Het
Scn7a	A	T	2: 66,741,985	I214N	probably damaging	Het
Setx	GTGGCT	GT	2: 29,154,061		probably null	Het
Suz12	G	T	11: 80,013,466	V211F	probably damaging	Het
Trim9	G	A	12: 70,346,352	H273Y	probably damaging	Het
Wdr70	A	T	15: 8,079,214	C149*	probably null	Het
Zfp940	T	C	7: 29,845,934	I183V	probably benign	Het

Other mutations in Uggt2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00158:Uggt2	APN	14	119049276	missense	possibly damaging	0.94
IGL00430:Uggt2	APN	14	119026429	nonsense	probably null
IGL00433:Uggt2	APN	14	119013487	missense	probably benign
IGL00572:Uggt2	APN	14	119042791	missense	probably benign	0.02
IGL00577:Uggt2	APN	14	119034900	missense	possibly damaging	0.89
IGL00671:Uggt2	APN	14	119042799	missense	possibly damaging	0.73
IGL01482:Uggt2	APN	14	119057645	missense	probably damaging	1.00
IGL01630:Uggt2	APN	14	119042772	missense	probably benign	0.00
IGL01787:Uggt2	APN	14	119081734	missense	probably damaging	0.99
IGL02063:Uggt2	APN	14	119089193	missense	possibly damaging	0.79
IGL02809:Uggt2	APN	14	119090738	missense	probably benign	0.17
IGL02894:Uggt2	APN	14	119081799	missense	probably damaging	0.96
IGL03062:Uggt2	APN	14	119075346	missense	probably damaging	1.00
IGL03139:Uggt2	APN	14	119095310	missense	probably benign	0.25
IGL03142:Uggt2	APN	14	118998191	missense	probably damaging	1.00
IGL03168:Uggt2	APN	14	119077668	missense	probably damaging	0.98
IGL03348:Uggt2	APN	14	119070888	missense	probably benign	0.38
P0014:Uggt2	UTSW	14	119044538	missense	probably damaging	1.00
R0006:Uggt2	UTSW	14	119049663	missense	probably benign	0.07
R0063:Uggt2	UTSW	14	119007130	splice site	probably benign
R0063:Uggt2	UTSW	14	119007130	splice site	probably benign
R0383:Uggt2	UTSW	14	119049451	missense	probably damaging	1.00
R0433:Uggt2	UTSW	14	119075329	critical splice donor site	probably null
R0472:Uggt2	UTSW	14	119095336	missense	probably damaging	1.00
R0609:Uggt2	UTSW	14	119095336	missense	probably damaging	1.00
R0645:Uggt2	UTSW	14	119057598	missense	probably benign	0.27
R0788:Uggt2	UTSW	14	119095400	splice site	probably benign
R0940:Uggt2	UTSW	14	119091192	critical splice donor site	probably null
R1567:Uggt2	UTSW	14	119009093	missense	possibly damaging	0.58
R1627:Uggt2	UTSW	14	119057663	missense	possibly damaging	0.95
R1682:Uggt2	UTSW	14	119054643	missense	probably benign	0.19
R1746:Uggt2	UTSW	14	119013503	missense	probably benign	0.00
R1785:Uggt2	UTSW	14	119061376	missense	probably damaging	1.00
R1786:Uggt2	UTSW	14	119061376	missense	probably damaging	1.00
R1799:Uggt2	UTSW	14	119032276	missense	probably benign	0.00
R1894:Uggt2	UTSW	14	119049718	missense	probably damaging	0.99
R1918:Uggt2	UTSW	14	119008055	splice site	probably benign
R2149:Uggt2	UTSW	14	119075345	missense	probably benign	0.02
R2168:Uggt2	UTSW	14	119019505	missense	probably damaging	1.00
R2219:Uggt2	UTSW	14	119075337	missense	probably damaging	1.00
R2220:Uggt2	UTSW	14	119075337	missense	probably damaging	1.00
R2240:Uggt2	UTSW	14	118995049	missense	probably damaging	1.00
R2331:Uggt2	UTSW	14	119026599	missense	possibly damaging	0.87
R2904:Uggt2	UTSW	14	119059109	missense	possibly damaging	0.74
R2906:Uggt2	UTSW	14	119019507	missense	probably benign	0.00
R2907:Uggt2	UTSW	14	119019507	missense	probably benign	0.00
R2908:Uggt2	UTSW	14	119019507	missense	probably benign	0.00
R2998:Uggt2	UTSW	14	119049385	missense	probably damaging	1.00
R3407:Uggt2	UTSW	14	119091270	missense	probably benign	0.39
R3722:Uggt2	UTSW	14	119041518	missense	probably damaging	1.00
R3749:Uggt2	UTSW	14	119057672	missense	probably benign	0.13
R4015:Uggt2	UTSW	14	119026433	missense	possibly damaging	0.47
R4016:Uggt2	UTSW	14	119026433	missense	possibly damaging	0.47
R4206:Uggt2	UTSW	14	119049262	missense	probably damaging	1.00
R4536:Uggt2	UTSW	14	119019558	missense	probably benign
R4642:Uggt2	UTSW	14	119034935	missense	probably benign	0.00
R4654:Uggt2	UTSW	14	119032258	missense	possibly damaging	0.46
R4770:Uggt2	UTSW	14	119029054	splice site	probably null
R4810:Uggt2	UTSW	14	119013521	missense	probably damaging	1.00
R4832:Uggt2	UTSW	14	119001847	missense	probably damaging	0.99
R4856:Uggt2	UTSW	14	119035964	splice site	probably null
R4886:Uggt2	UTSW	14	119035964	splice site	probably null
R4888:Uggt2	UTSW	14	119049253	missense	probably damaging	1.00
R4888:Uggt2	UTSW	14	119077650	critical splice donor site	probably null
R4895:Uggt2	UTSW	14	119018886	missense	probably damaging	1.00
R5353:Uggt2	UTSW	14	119081770	missense	probably benign	0.00
R5423:Uggt2	UTSW	14	119019486	missense	probably damaging	1.00
R5476:Uggt2	UTSW	14	119090709	missense	probably benign	0.01
R5561:Uggt2	UTSW	14	119041527	missense	probably benign	0.02
R5607:Uggt2	UTSW	14	119089199	missense	possibly damaging	0.81
R5608:Uggt2	UTSW	14	119089199	missense	possibly damaging	0.81
R5625:Uggt2	UTSW	14	119077724	missense	probably damaging	1.00
R5698:Uggt2	UTSW	14	119042726	missense	probably damaging	1.00
R5986:Uggt2	UTSW	14	119049426	missense	probably damaging	1.00
R6031:Uggt2	UTSW	14	119070826	missense	probably benign	0.06
R6031:Uggt2	UTSW	14	119070826	missense	probably benign	0.06
R6056:Uggt2	UTSW	14	119035969	critical splice donor site	probably null
R6289:Uggt2	UTSW	14	119041602	missense	probably damaging	0.99
R6480:Uggt2	UTSW	14	119057564	missense	probably benign	0.01
R6515:Uggt2	UTSW	14	119077719	missense	possibly damaging	0.89
R6706:Uggt2	UTSW	14	119070881	missense	probably damaging	1.00
R6745:Uggt2	UTSW	14	119042610	missense	possibly damaging	0.58
R6819:Uggt2	UTSW	14	119026435	missense	probably damaging	1.00
R6879:Uggt2	UTSW	14	119001859	missense	probably benign	0.10
R7117:Uggt2	UTSW	14	119014526	missense	probably benign	0.25
R7183:Uggt2	UTSW	14	119019637	splice site	probably null
R7337:Uggt2	UTSW	14	119086175	missense	probably benign	0.28
R7342:Uggt2	UTSW	14	118994972	missense	possibly damaging	0.56
R7615:Uggt2	UTSW	14	119089269	missense	probably benign	0.12
R7625:Uggt2	UTSW	14	119026493	missense	probably damaging	1.00
R7685:Uggt2	UTSW	14	119075347	missense	probably damaging	1.00
R7842:Uggt2	UTSW	14	118998104	missense	probably damaging	1.00
R7891:Uggt2	UTSW	14	119042647	missense	probably benign	0.09
R7938:Uggt2	UTSW	14	119059107	missense	possibly damaging	0.68
R8050:Uggt2	UTSW	14	119026422	missense	probably damaging	0.98
Z1177:Uggt2	UTSW	14	119007296	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACACGCATGGCTTGAAAGTAG -3'
(R):5'- TAGCACAGATACTCTAACTCAGCTC -3'

Sequencing Primer
(F):5'- CGCATGGCTTGAAAGTAGAAGTAAG -3'
(R):5'- AACAGCTTTTACCGTTTTGTTCTGG -3'

Posted On

2015-04-29