Incidental Mutation 'R4017:Actn3'
ID312009
Institutional Source Beutler Lab
Gene Symbol Actn3
Ensembl Gene ENSMUSG00000006457
Gene Nameactinin alpha 3
Synonyms
MMRRC Submission 041611-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.498) question?
Stock #R4017 (G1)
Quality Score187
Status Validated
Chromosome19
Chromosomal Location4861223-4877909 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 4867546 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 423 (T423N)
Ref Sequence ENSEMBL: ENSMUSP00000006626 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006626]
Predicted Effect possibly damaging
Transcript: ENSMUST00000006626
AA Change: T423N

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000006626
Gene: ENSMUSG00000006457
AA Change: T423N

DomainStartEndE-ValueType
low complexity region 8 30 N/A INTRINSIC
CH 46 146 1.4e-23 SMART
CH 159 258 4.83e-27 SMART
low complexity region 261 272 N/A INTRINSIC
Pfam:Spectrin 287 397 5.5e-15 PFAM
SPEC 410 511 3.78e-23 SMART
SPEC 525 632 2.37e-6 SMART
Pfam:Spectrin 643 746 4.1e-15 PFAM
EFh 763 791 7.93e-1 SMART
EFh 799 827 5.96e-1 SMART
efhand_Ca_insen 830 896 2.29e-34 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138811
Meta Mutation Damage Score 0.0822 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: This gene encodes a member of the alpha-actin binding protein gene family. The encoded protein is primarily expressed in skeletal muscle and functions as a structural component of sarcomeric Z line. This protein is involved in crosslinking actin containing thin filaments. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit an increase mitochondria density and a shift from anaerobic to aerobic metabolism in fast muscle fiber that is associated with increased aerobic capacity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apold1 A G 6: 134,983,906 I108V probably benign Het
Arhgap21 G T 2: 20,892,104 F121L probably benign Het
BC004004 T C 17: 29,298,732 S307P probably damaging Het
Cpeb4 A G 11: 31,924,671 D484G probably damaging Het
Dctpp1 G A 7: 127,257,113 R146C probably damaging Het
Dnm2 A G 9: 21,494,604 Y553C probably damaging Het
Dync1h1 G T 12: 110,643,190 R2802I probably damaging Het
Eif2a T A 3: 58,545,355 M209K probably damaging Het
Epb41 A T 4: 131,982,445 probably benign Het
Fnip1 A G 11: 54,509,987 K1071E probably benign Het
Igf2bp2 T C 16: 22,063,676 N425S probably damaging Het
Kdm5a T A 6: 120,394,106 Y504N probably damaging Het
Kif1a T C 1: 93,076,292 D156G probably damaging Het
Klhl10 G A 11: 100,445,674 M162I probably benign Het
Lrp1b A G 2: 40,802,984 F3401L possibly damaging Het
Lrp6 G T 6: 134,520,550 R165S probably damaging Het
Muc5b G A 7: 141,863,630 V3438M probably benign Het
Myo3a A G 2: 22,578,170 R479G possibly damaging Het
Npr1 T C 3: 90,456,232 E828G probably damaging Het
Obscn A G 11: 59,132,622 F643S probably damaging Het
Olfr1112 A G 2: 87,192,502 S272G probably benign Het
Olfr748 A T 14: 50,710,876 D182V probably benign Het
Pcdhga8 T C 18: 37,815,738 V69A probably damaging Het
Ppp6r1 C A 7: 4,633,744 C688F probably benign Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rnf157 A T 11: 116,359,241 probably null Het
Saxo1 A T 4: 86,557,996 I7N possibly damaging Het
Scn7a A T 2: 66,741,985 I214N probably damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Suz12 G T 11: 80,013,466 V211F probably damaging Het
Trim9 G A 12: 70,346,352 H273Y probably damaging Het
Uggt2 T C 14: 119,026,433 N1062D possibly damaging Het
Wdr70 A T 15: 8,079,214 C149* probably null Het
Zfp940 T C 7: 29,845,934 I183V probably benign Het
Other mutations in Actn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
ballooned UTSW 19 4871848 missense probably damaging 1.00
PIT4480001:Actn3 UTSW 19 4867577 nonsense probably null
R0128:Actn3 UTSW 19 4871615 missense probably damaging 1.00
R1174:Actn3 UTSW 19 4864756 missense probably damaging 1.00
R1181:Actn3 UTSW 19 4872610 missense probably benign 0.07
R1239:Actn3 UTSW 19 4865455 unclassified probably benign
R1445:Actn3 UTSW 19 4865455 unclassified probably benign
R1698:Actn3 UTSW 19 4862207 missense possibly damaging 0.55
R2127:Actn3 UTSW 19 4871675 missense probably damaging 1.00
R4293:Actn3 UTSW 19 4865440 missense probably benign 0.09
R4482:Actn3 UTSW 19 4863408 critical splice donor site probably null
R4840:Actn3 UTSW 19 4864511 missense probably damaging 1.00
R4868:Actn3 UTSW 19 4864454 missense probably benign 0.24
R5152:Actn3 UTSW 19 4863544 missense probably damaging 1.00
R5349:Actn3 UTSW 19 4867958 missense possibly damaging 0.94
R5420:Actn3 UTSW 19 4865344 frame shift probably null
R5448:Actn3 UTSW 19 4863211 missense possibly damaging 0.94
R5563:Actn3 UTSW 19 4872316 missense probably damaging 1.00
R5753:Actn3 UTSW 19 4864567 critical splice acceptor site probably null
R6457:Actn3 UTSW 19 4871848 missense probably damaging 1.00
R7236:Actn3 UTSW 19 4871616 missense probably benign 0.07
R7470:Actn3 UTSW 19 4867814 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TGCATAGCAACAAGTCAGGATG -3'
(R):5'- ATGGAGGCCACCTTTGTTTTCC -3'

Sequencing Primer
(F):5'- AGGTCCAGTAGCTCATGTCC -3'
(R):5'- TCCACTCAGGACATAGCCAATG -3'
Posted On2015-04-29