Incidental Mutation 'R4018:Edem3'
ID312010
Institutional Source Beutler Lab
Gene Symbol Edem3
Ensembl Gene ENSMUSG00000043019
Gene NameER degradation enhancer, mannosidase alpha-like 3
Synonyms2310050N11Rik
MMRRC Submission 040848-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.346) question?
Stock #R4018 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location151755371-151822051 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 151804826 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059498] [ENSMUST00000187951] [ENSMUST00000188145] [ENSMUST00000191070]
Predicted Effect probably benign
Transcript: ENSMUST00000059498
SMART Domains Protein: ENSMUSP00000058941
Gene: ENSMUSG00000043019

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Pfam:Glyco_hydro_47 60 499 3.5e-118 PFAM
low complexity region 635 648 N/A INTRINSIC
Pfam:PA 672 778 9.4e-16 PFAM
low complexity region 838 855 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187951
SMART Domains Protein: ENSMUSP00000140775
Gene: ENSMUSG00000043019

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Pfam:Glyco_hydro_47 60 499 1.8e-147 PFAM
low complexity region 617 630 N/A INTRINSIC
Pfam:PA 658 762 1.6e-17 PFAM
low complexity region 820 837 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188145
SMART Domains Protein: ENSMUSP00000140443
Gene: ENSMUSG00000043019

DomainStartEndE-ValueType
signal peptide 1 42 N/A INTRINSIC
Pfam:Glyco_hydro_47 60 499 3.3e-144 PFAM
low complexity region 635 648 N/A INTRINSIC
Pfam:PA 676 780 4.3e-15 PFAM
low complexity region 854 871 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191070
SMART Domains Protein: ENSMUSP00000140234
Gene: ENSMUSG00000043019

DomainStartEndE-ValueType
signal peptide 1 42 N/A INTRINSIC
Pfam:Glyco_hydro_47 60 499 3e-144 PFAM
low complexity region 616 629 N/A INTRINSIC
Pfam:PA 657 761 4.1e-15 PFAM
low complexity region 824 841 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 92.4%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Quality control in the endoplasmic reticulum (ER) ensures that only properly folded proteins are retained in the cell through recognition and degradation of misfolded or unassembled proteins. EDEM3 belongs to a group of proteins that accelerate degradation of misfolded glycoproteins in the ER (Hirao et al., 2006 [PubMed 16431915]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aga A G 8: 53,523,191 K319R probably benign Het
Brip1 G T 11: 86,138,851 T619K possibly damaging Het
Cd300ld2 G T 11: 115,012,504 probably benign Het
Cd300lg A G 11: 102,041,594 R2G probably damaging Het
Celsr2 C T 3: 108,394,965 V2616I possibly damaging Het
Endou T A 15: 97,718,937 K235M probably damaging Het
Gm5431 T A 11: 48,889,168 N309I probably damaging Het
Il4 T A 11: 53,613,979 probably benign Het
Iws1 C A 18: 32,070,152 S27* probably null Het
Kdm5d T C Y: 910,441 probably benign Het
Ldb3 T C 14: 34,552,171 probably benign Het
Llgl2 A G 11: 115,847,612 T284A probably benign Het
Maml1 A T 11: 50,265,784 N521K probably damaging Het
Mlxipl T C 5: 135,132,672 Y482H probably damaging Het
Notch2 G T 3: 98,104,565 C633F probably damaging Het
Oc90 T C 15: 65,887,608 D232G probably benign Het
Olfr1453 T C 19: 13,027,825 E168G probably benign Het
Polr2a T C 11: 69,735,059 Y1717C unknown Het
Prkca T A 11: 107,939,602 I221F probably damaging Het
Rab3c T A 13: 110,084,194 K144N probably damaging Het
Ryr2 T A 13: 11,918,414 N57I probably damaging Het
Scyl3 A G 1: 163,936,499 T145A possibly damaging Het
Sept4 G A 11: 87,585,121 R162Q probably damaging Het
Slc25a39 A T 11: 102,405,024 L127H probably damaging Het
Slc9a9 T C 9: 94,685,163 V95A probably benign Het
Tsc2 T C 17: 24,625,281 I279V probably damaging Het
Usp34 C T 11: 23,489,033 P3532S possibly damaging Het
Vmn2r6 T C 3: 64,556,472 I314V probably benign Het
Wdr66 A G 5: 123,322,454 I1160V probably benign Het
Other mutations in Edem3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Edem3 APN 1 151818513 missense probably benign
IGL01065:Edem3 APN 1 151777551 missense probably damaging 1.00
IGL01351:Edem3 APN 1 151792385 missense possibly damaging 0.95
IGL01451:Edem3 APN 1 151818628 missense probably benign 0.21
IGL01831:Edem3 APN 1 151796082 missense probably damaging 0.97
IGL02096:Edem3 APN 1 151804719 missense probably benign 0.00
IGL02207:Edem3 APN 1 151808360 missense possibly damaging 0.77
IGL02507:Edem3 APN 1 151811656 missense probably benign 0.20
IGL02690:Edem3 APN 1 151804799 missense probably damaging 1.00
Abel UTSW 1 151811519 missense probably damaging 1.00
adam UTSW 1 151811596 nonsense probably null
eve UTSW 1 151812614 splice site probably null
R0421:Edem3 UTSW 1 151792438 splice site probably benign
R1463:Edem3 UTSW 1 151807510 missense possibly damaging 0.81
R1934:Edem3 UTSW 1 151804283 missense probably damaging 1.00
R1958:Edem3 UTSW 1 151804325 missense probably damaging 1.00
R2090:Edem3 UTSW 1 151804826 splice site probably benign
R2126:Edem3 UTSW 1 151794731 missense possibly damaging 0.76
R2191:Edem3 UTSW 1 151796883 missense probably damaging 1.00
R2211:Edem3 UTSW 1 151804702 missense possibly damaging 0.74
R4005:Edem3 UTSW 1 151759755 missense probably damaging 1.00
R4723:Edem3 UTSW 1 151804698 missense possibly damaging 0.95
R4818:Edem3 UTSW 1 151792385 missense possibly damaging 0.95
R4871:Edem3 UTSW 1 151804231 splice site probably null
R5205:Edem3 UTSW 1 151811519 missense probably damaging 1.00
R5347:Edem3 UTSW 1 151807451 missense probably damaging 0.97
R5910:Edem3 UTSW 1 151770827 splice site probably null
R7021:Edem3 UTSW 1 151755672 missense probably benign 0.01
R7366:Edem3 UTSW 1 151812614 splice site probably null
R7481:Edem3 UTSW 1 151808222 missense probably damaging 0.98
R7481:Edem3 UTSW 1 151808223 missense possibly damaging 0.46
R7734:Edem3 UTSW 1 151818585 missense probably benign 0.00
R7773:Edem3 UTSW 1 151811596 nonsense probably null
R7828:Edem3 UTSW 1 151811635 missense possibly damaging 0.51
R8556:Edem3 UTSW 1 151784835 missense possibly damaging 0.77
X0028:Edem3 UTSW 1 151818562 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- GGAGGGGTTACTTACAATATTGTCTC -3'
(R):5'- TGTCTTTCCACTATGCAGAAACTAC -3'

Sequencing Primer
(F):5'- TGTCTCATTTTCTTTTAGGACATCAC -3'
(R):5'- CACTATGCAGAAACTACAAAGAAAAC -3'
Posted On2015-04-29