Mutagenetix > Incidental Mutations

Incidental Mutation 'R4018:Edem3'

312010

Institutional Source

Beutler Lab

Gene Symbol

Edem3

Ensembl Gene

ENSMUSG00000043019

Gene Name

ER degradation enhancer, mannosidase alpha-like 3

Synonyms

2310050N11Rik

MMRRC Submission

040848-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.346) question?

Stock #

R4018 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

151755371-151822051 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

C to T at 151804826 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000140234 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000059498] [ENSMUST00000187951] [ENSMUST00000188145] [ENSMUST00000191070]

Predicted Effect

probably benign
Transcript: ENSMUST00000059498

SMART Domains

Protein: ENSMUSP00000058941
Gene: ENSMUSG00000043019

Domain	Start	End	E-Value	Type
signal peptide	1	34	N/A	INTRINSIC
Pfam:Glyco_hydro_47	60	499	3.5e-118	PFAM
low complexity region	635	648	N/A	INTRINSIC
Pfam:PA	672	778	9.4e-16	PFAM
low complexity region	838	855	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000187951

SMART Domains

Protein: ENSMUSP00000140775
Gene: ENSMUSG00000043019

Domain	Start	End	E-Value	Type
signal peptide	1	34	N/A	INTRINSIC
Pfam:Glyco_hydro_47	60	499	1.8e-147	PFAM
low complexity region	617	630	N/A	INTRINSIC
Pfam:PA	658	762	1.6e-17	PFAM
low complexity region	820	837	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000188145

SMART Domains

Protein: ENSMUSP00000140443
Gene: ENSMUSG00000043019

Domain	Start	End	E-Value	Type
signal peptide	1	42	N/A	INTRINSIC
Pfam:Glyco_hydro_47	60	499	3.3e-144	PFAM
low complexity region	635	648	N/A	INTRINSIC
Pfam:PA	676	780	4.3e-15	PFAM
low complexity region	854	871	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000191070

SMART Domains

Protein: ENSMUSP00000140234
Gene: ENSMUSG00000043019

Domain	Start	End	E-Value	Type
signal peptide	1	42	N/A	INTRINSIC
Pfam:Glyco_hydro_47	60	499	3e-144	PFAM
low complexity region	616	629	N/A	INTRINSIC
Pfam:PA	657	761	4.1e-15	PFAM
low complexity region	824	841	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 92.4%

Validation Efficiency

100% (33/33)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Quality control in the endoplasmic reticulum (ER) ensures that only properly folded proteins are retained in the cell through recognition and degradation of misfolded or unassembled proteins. EDEM3 belongs to a group of proteins that accelerate degradation of misfolded glycoproteins in the ER (Hirao et al., 2006 [PubMed 16431915]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 29 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aga	A	G	8: 53,523,191	K319R	probably benign	Het
Brip1	G	T	11: 86,138,851	T619K	possibly damaging	Het
Cd300ld2	G	T	11: 115,012,504		probably benign	Het
Cd300lg	A	G	11: 102,041,594	R2G	probably damaging	Het
Celsr2	C	T	3: 108,394,965	V2616I	possibly damaging	Het
Endou	T	A	15: 97,718,937	K235M	probably damaging	Het
Gm5431	T	A	11: 48,889,168	N309I	probably damaging	Het
Il4	T	A	11: 53,613,979		probably benign	Het
Iws1	C	A	18: 32,070,152	S27*	probably null	Het
Kdm5d	T	C	Y: 910,441		probably benign	Het
Ldb3	T	C	14: 34,552,171		probably benign	Het
Llgl2	A	G	11: 115,847,612	T284A	probably benign	Het
Maml1	A	T	11: 50,265,784	N521K	probably damaging	Het
Mlxipl	T	C	5: 135,132,672	Y482H	probably damaging	Het
Notch2	G	T	3: 98,104,565	C633F	probably damaging	Het
Oc90	T	C	15: 65,887,608	D232G	probably benign	Het
Olfr1453	T	C	19: 13,027,825	E168G	probably benign	Het
Polr2a	T	C	11: 69,735,059	Y1717C	unknown	Het
Prkca	T	A	11: 107,939,602	I221F	probably damaging	Het
Rab3c	T	A	13: 110,084,194	K144N	probably damaging	Het
Ryr2	T	A	13: 11,918,414	N57I	probably damaging	Het
Scyl3	A	G	1: 163,936,499	T145A	possibly damaging	Het
Sept4	G	A	11: 87,585,121	R162Q	probably damaging	Het
Slc25a39	A	T	11: 102,405,024	L127H	probably damaging	Het
Slc9a9	T	C	9: 94,685,163	V95A	probably benign	Het
Tsc2	T	C	17: 24,625,281	I279V	probably damaging	Het
Usp34	C	T	11: 23,489,033	P3532S	possibly damaging	Het
Vmn2r6	T	C	3: 64,556,472	I314V	probably benign	Het
Wdr66	A	G	5: 123,322,454	I1160V	probably benign	Het

Other mutations in Edem3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00503:Edem3	APN	1	151818513	missense	probably benign
IGL01065:Edem3	APN	1	151777551	missense	probably damaging	1.00
IGL01351:Edem3	APN	1	151792385	missense	possibly damaging	0.95
IGL01451:Edem3	APN	1	151818628	missense	probably benign	0.21
IGL01831:Edem3	APN	1	151796082	missense	probably damaging	0.97
IGL02096:Edem3	APN	1	151804719	missense	probably benign	0.00
IGL02207:Edem3	APN	1	151808360	missense	possibly damaging	0.77
IGL02507:Edem3	APN	1	151811656	missense	probably benign	0.20
IGL02690:Edem3	APN	1	151804799	missense	probably damaging	1.00
Abel	UTSW	1	151811519	missense	probably damaging	1.00
adam	UTSW	1	151811596	nonsense	probably null
eve	UTSW	1	151812614	splice site	probably null
R0421:Edem3	UTSW	1	151792438	splice site	probably benign
R1463:Edem3	UTSW	1	151807510	missense	possibly damaging	0.81
R1934:Edem3	UTSW	1	151804283	missense	probably damaging	1.00
R1958:Edem3	UTSW	1	151804325	missense	probably damaging	1.00
R2090:Edem3	UTSW	1	151804826	splice site	probably benign
R2126:Edem3	UTSW	1	151794731	missense	possibly damaging	0.76
R2191:Edem3	UTSW	1	151796883	missense	probably damaging	1.00
R2211:Edem3	UTSW	1	151804702	missense	possibly damaging	0.74
R4005:Edem3	UTSW	1	151759755	missense	probably damaging	1.00
R4723:Edem3	UTSW	1	151804698	missense	possibly damaging	0.95
R4818:Edem3	UTSW	1	151792385	missense	possibly damaging	0.95
R4871:Edem3	UTSW	1	151804231	splice site	probably null
R5205:Edem3	UTSW	1	151811519	missense	probably damaging	1.00
R5347:Edem3	UTSW	1	151807451	missense	probably damaging	0.97
R5910:Edem3	UTSW	1	151770827	splice site	probably null
R7021:Edem3	UTSW	1	151755672	missense	probably benign	0.01
R7366:Edem3	UTSW	1	151812614	splice site	probably null
R7481:Edem3	UTSW	1	151808222	missense	probably damaging	0.98
R7481:Edem3	UTSW	1	151808223	missense	possibly damaging	0.46
R7734:Edem3	UTSW	1	151818585	missense	probably benign	0.00
R7773:Edem3	UTSW	1	151811596	nonsense	probably null
R7828:Edem3	UTSW	1	151811635	missense	possibly damaging	0.51
R8556:Edem3	UTSW	1	151784835	missense	possibly damaging	0.77
X0028:Edem3	UTSW	1	151818562	missense	probably benign	0.24

Predicted Primers

PCR Primer
(F):5'- GGAGGGGTTACTTACAATATTGTCTC -3'
(R):5'- TGTCTTTCCACTATGCAGAAACTAC -3'

Sequencing Primer
(F):5'- TGTCTCATTTTCTTTTAGGACATCAC -3'
(R):5'- CACTATGCAGAAACTACAAAGAAAAC -3'

Posted On

2015-04-29