Mutagenetix > Incidental Mutations

Incidental Mutation 'R4018:Mlxipl'

312017

Institutional Source

Beutler Lab

Gene Symbol

Mlxipl

Ensembl Gene

ENSMUSG00000005373

Gene Name

MLX interacting protein-like

Synonyms

WS-bHLH, Wbscr14, bHLHd14, ChREBP

MMRRC Submission

040848-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.471) question?

Stock #

R4018 (G1)

Quality Score

211

Status

Validated

Chromosome

Chromosomal Location

135089890-135138382 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 135132672 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 482 (Y482H)

Ref Sequence

ENSEMBL: ENSMUSP00000144328 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005507] [ENSMUST00000128691] [ENSMUST00000129008] [ENSMUST00000142385] [ENSMUST00000153519]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000005507
AA Change: Y482H

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000005507
Gene: ENSMUSG00000005373
AA Change: Y482H

Domain	Start	End	E-Value	Type
low complexity region	19	34	N/A	INTRINSIC
PDB:4GNT\|B	117	137	1e-8	PDB
low complexity region	261	271	N/A	INTRINSIC
low complexity region	341	350	N/A	INTRINSIC
low complexity region	387	408	N/A	INTRINSIC
low complexity region	414	437	N/A	INTRINSIC
low complexity region	457	473	N/A	INTRINSIC
low complexity region	513	531	N/A	INTRINSIC
low complexity region	574	603	N/A	INTRINSIC
HLH	667	721	1.14e-9	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000123370

SMART Domains

Protein: ENSMUSP00000116358
Gene: ENSMUSG00000005373

Domain	Start	End	E-Value	Type
HLH	19	73	1.14e-9	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000128691
AA Change: Y482H

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000121348
Gene: ENSMUSG00000005373
AA Change: Y482H

Domain	Start	End	E-Value	Type
low complexity region	19	34	N/A	INTRINSIC
PDB:4GNT\|B	117	137	9e-9	PDB
low complexity region	261	271	N/A	INTRINSIC
low complexity region	341	350	N/A	INTRINSIC
low complexity region	387	408	N/A	INTRINSIC
low complexity region	414	437	N/A	INTRINSIC
low complexity region	457	473	N/A	INTRINSIC
low complexity region	513	531	N/A	INTRINSIC
low complexity region	574	603	N/A	INTRINSIC
SCOP:d1hloa_	658	709	6e-7	SMART
Blast:HLH	667	699	1e-12	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000129008
AA Change: Y482H

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000114933
Gene: ENSMUSG00000005373
AA Change: Y482H

Domain	Start	End	E-Value	Type
low complexity region	19	34	N/A	INTRINSIC
PDB:4GNT\|B	117	137	7e-9	PDB
low complexity region	261	271	N/A	INTRINSIC
low complexity region	341	350	N/A	INTRINSIC
low complexity region	387	408	N/A	INTRINSIC
low complexity region	414	437	N/A	INTRINSIC
low complexity region	457	473	N/A	INTRINSIC
low complexity region	513	531	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000142385
AA Change: Y482H

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000144328
Gene: ENSMUSG00000005373
AA Change: Y482H

Domain	Start	End	E-Value	Type
low complexity region	19	34	N/A	INTRINSIC
PDB:4GNT\|B	117	137	7e-9	PDB
low complexity region	261	271	N/A	INTRINSIC
low complexity region	341	350	N/A	INTRINSIC
low complexity region	387	408	N/A	INTRINSIC
low complexity region	414	437	N/A	INTRINSIC
low complexity region	457	473	N/A	INTRINSIC
low complexity region	513	531	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000153519
AA Change: Y482H

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000122198
Gene: ENSMUSG00000005373
AA Change: Y482H

Domain	Start	End	E-Value	Type
low complexity region	19	34	N/A	INTRINSIC
PDB:4GNT\|B	117	137	9e-9	PDB
low complexity region	261	271	N/A	INTRINSIC
low complexity region	341	350	N/A	INTRINSIC
low complexity region	387	408	N/A	INTRINSIC
low complexity region	414	437	N/A	INTRINSIC
low complexity region	457	473	N/A	INTRINSIC
low complexity region	513	531	N/A	INTRINSIC
low complexity region	574	603	N/A	INTRINSIC
SCOP:d1am9a_	658	696	1e-5	SMART
Blast:HLH	667	698	2e-12	BLAST
low complexity region	728	744	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000154840

SMART Domains

Protein: ENSMUSP00000121668
Gene: ENSMUSG00000005373

Domain	Start	End	E-Value	Type
HLH	26	120	7.9e-4	SMART

Meta Mutation Damage Score

0.0741

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 92.4%

Validation Efficiency

100% (33/33)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a basic helix-loop-helix leucine zipper transcription factor of the Myc/Max/Mad superfamily. This protein forms a heterodimeric complex and binds and activates, in a glucose-dependent manner, carbohydrate response element (ChoRE) motifs in the promoters of triglyceride synthesis genes. The gene is deleted in Williams-Beuren syndrome, a multisystem developmental disorder caused by the deletion of contiguous genes at chromosome 7q11.23. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced glycolysis and lipogenesis and severe simple carbohydrate intolerance. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 29 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aga	A	G	8: 53,523,191	K319R	probably benign	Het
Brip1	G	T	11: 86,138,851	T619K	possibly damaging	Het
Cd300ld2	G	T	11: 115,012,504		probably benign	Het
Cd300lg	A	G	11: 102,041,594	R2G	probably damaging	Het
Celsr2	C	T	3: 108,394,965	V2616I	possibly damaging	Het
Edem3	C	T	1: 151,804,826		probably benign	Het
Endou	T	A	15: 97,718,937	K235M	probably damaging	Het
Gm5431	T	A	11: 48,889,168	N309I	probably damaging	Het
Il4	T	A	11: 53,613,979		probably benign	Het
Iws1	C	A	18: 32,070,152	S27*	probably null	Het
Kdm5d	T	C	Y: 910,441		probably benign	Het
Ldb3	T	C	14: 34,552,171		probably benign	Het
Llgl2	A	G	11: 115,847,612	T284A	probably benign	Het
Maml1	A	T	11: 50,265,784	N521K	probably damaging	Het
Notch2	G	T	3: 98,104,565	C633F	probably damaging	Het
Oc90	T	C	15: 65,887,608	D232G	probably benign	Het
Olfr1453	T	C	19: 13,027,825	E168G	probably benign	Het
Polr2a	T	C	11: 69,735,059	Y1717C	unknown	Het
Prkca	T	A	11: 107,939,602	I221F	probably damaging	Het
Rab3c	T	A	13: 110,084,194	K144N	probably damaging	Het
Ryr2	T	A	13: 11,918,414	N57I	probably damaging	Het
Scyl3	A	G	1: 163,936,499	T145A	possibly damaging	Het
Sept4	G	A	11: 87,585,121	R162Q	probably damaging	Het
Slc25a39	A	T	11: 102,405,024	L127H	probably damaging	Het
Slc9a9	T	C	9: 94,685,163	V95A	probably benign	Het
Tsc2	T	C	17: 24,625,281	I279V	probably damaging	Het
Usp34	C	T	11: 23,489,033	P3532S	possibly damaging	Het
Vmn2r6	T	C	3: 64,556,472	I314V	probably benign	Het
Wdr66	A	G	5: 123,322,454	I1160V	probably benign	Het

Other mutations in Mlxipl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00771:Mlxipl	APN	5	135132778	missense	probably damaging	0.98
IGL01872:Mlxipl	APN	5	135113691	missense	probably damaging	1.00
IGL02694:Mlxipl	APN	5	135124018	critical splice donor site	probably null
IGL03070:Mlxipl	APN	5	135132453	missense	possibly damaging	0.93
Scarlet	UTSW	5	135134030	missense	possibly damaging	0.93
H8441:Mlxipl	UTSW	5	135123961	missense	probably damaging	1.00
IGL03054:Mlxipl	UTSW	5	135133256	missense	possibly damaging	0.83
R0003:Mlxipl	UTSW	5	135133189	unclassified	probably benign
R0126:Mlxipl	UTSW	5	135132323	missense	probably damaging	0.96
R0458:Mlxipl	UTSW	5	135133370	missense	probably benign	0.33
R0513:Mlxipl	UTSW	5	135137263	missense	probably benign	0.33
R0580:Mlxipl	UTSW	5	135123975	missense	probably benign	0.01
R0744:Mlxipl	UTSW	5	135132475	missense	possibly damaging	0.86
R0827:Mlxipl	UTSW	5	135132738	missense	probably benign	0.00
R1052:Mlxipl	UTSW	5	135113710	missense	probably damaging	1.00
R1241:Mlxipl	UTSW	5	135132718	missense	probably benign	0.01
R1795:Mlxipl	UTSW	5	135107170	missense	probably damaging	1.00
R1903:Mlxipl	UTSW	5	135133568	missense	possibly damaging	0.92
R2038:Mlxipl	UTSW	5	135106999	missense	probably damaging	1.00
R2064:Mlxipl	UTSW	5	135132777	missense	possibly damaging	0.77
R2069:Mlxipl	UTSW	5	135107005	missense	probably damaging	1.00
R2081:Mlxipl	UTSW	5	135113638	missense	probably damaging	1.00
R2095:Mlxipl	UTSW	5	135122120	splice site	probably benign
R3114:Mlxipl	UTSW	5	135133662	splice site	probably benign
R4090:Mlxipl	UTSW	5	135132527	missense	probably benign	0.33
R4321:Mlxipl	UTSW	5	135135450	nonsense	probably null
R4414:Mlxipl	UTSW	5	135137399	unclassified	probably benign
R5706:Mlxipl	UTSW	5	135133604	missense	probably benign	0.33
R6088:Mlxipl	UTSW	5	135134030	missense	possibly damaging	0.93
R6508:Mlxipl	UTSW	5	135128620	missense	probably benign	0.03
R6704:Mlxipl	UTSW	5	135137240	critical splice acceptor site	probably null
R7060:Mlxipl	UTSW	5	135132315	missense	possibly damaging	0.88
R7095:Mlxipl	UTSW	5	135134030	missense	possibly damaging	0.93
R7128:Mlxipl	UTSW	5	135133851	missense	probably damaging	0.98
R7464:Mlxipl	UTSW	5	135133628	missense	probably benign	0.01
R7510:Mlxipl	UTSW	5	135133118	missense	possibly damaging	0.72
R7669:Mlxipl	UTSW	5	135132370	missense	possibly damaging	0.53
R7737:Mlxipl	UTSW	5	135135381	missense	possibly damaging	0.73
R7806:Mlxipl	UTSW	5	135134543	missense	possibly damaging	0.93
R7910:Mlxipl	UTSW	5	135132409	missense	possibly damaging	0.85
R8118:Mlxipl	UTSW	5	135137248	missense	possibly damaging	0.96
R8363:Mlxipl	UTSW	5	135107076	missense	probably benign	0.18

Predicted Primers

PCR Primer
(F):5'- CCCCTCTTTGTTGCCAGAAG -3'
(R):5'- AGAGTCGCTTCCTCCCAGTATC -3'

Sequencing Primer
(F):5'- TGTTGCCAGAAGAATCTCTCC -3'
(R):5'- CCTGAGCAGCTGTGTAAGAC -3'

Posted On

2015-04-29