Incidental Mutation 'R4018:Aga'
ID312018
Institutional Source Beutler Lab
Gene Symbol Aga
Ensembl Gene ENSMUSG00000031521
Gene Nameaspartylglucosaminidase
Synonyms
MMRRC Submission 040848-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4018 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location53511727-53523421 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 53523191 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 319 (K319R)
Ref Sequence ENSEMBL: ENSMUSP00000033920 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033920] [ENSMUST00000209811] [ENSMUST00000211424]
Predicted Effect probably benign
Transcript: ENSMUST00000033920
AA Change: K319R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000033920
Gene: ENSMUSG00000031521
AA Change: K319R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Asparaginase_2 32 333 2.5e-86 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209811
Predicted Effect probably benign
Transcript: ENSMUST00000211424
AA Change: K309R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0948 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 92.4%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: This gene encodes an amidase enzyme that participates in the breakdown of glycoproteins in the cell. The encoded protein undergoes proteolytic processing to generate a mature enzyme. Mice lacking the encoded protein exhibit accumulation of aspartylglucosamine along with lysosomal vacuolization, axonal swelling in the gracile nucleus and impaired neuromotor coordination. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate mature protein. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate this gene die prematurely and share most of the clinical, biochemical and histopathological characteristics of human aspartylglycosaminuria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Brip1 G T 11: 86,138,851 T619K possibly damaging Het
Cd300ld2 G T 11: 115,012,504 probably benign Het
Cd300lg A G 11: 102,041,594 R2G probably damaging Het
Celsr2 C T 3: 108,394,965 V2616I possibly damaging Het
Edem3 C T 1: 151,804,826 probably benign Het
Endou T A 15: 97,718,937 K235M probably damaging Het
Gm5431 T A 11: 48,889,168 N309I probably damaging Het
Il4 T A 11: 53,613,979 probably benign Het
Iws1 C A 18: 32,070,152 S27* probably null Het
Kdm5d T C Y: 910,441 probably benign Het
Ldb3 T C 14: 34,552,171 probably benign Het
Llgl2 A G 11: 115,847,612 T284A probably benign Het
Maml1 A T 11: 50,265,784 N521K probably damaging Het
Mlxipl T C 5: 135,132,672 Y482H probably damaging Het
Notch2 G T 3: 98,104,565 C633F probably damaging Het
Oc90 T C 15: 65,887,608 D232G probably benign Het
Olfr1453 T C 19: 13,027,825 E168G probably benign Het
Polr2a T C 11: 69,735,059 Y1717C unknown Het
Prkca T A 11: 107,939,602 I221F probably damaging Het
Rab3c T A 13: 110,084,194 K144N probably damaging Het
Ryr2 T A 13: 11,918,414 N57I probably damaging Het
Scyl3 A G 1: 163,936,499 T145A possibly damaging Het
Sept4 G A 11: 87,585,121 R162Q probably damaging Het
Slc25a39 A T 11: 102,405,024 L127H probably damaging Het
Slc9a9 T C 9: 94,685,163 V95A probably benign Het
Tsc2 T C 17: 24,625,281 I279V probably damaging Het
Usp34 C T 11: 23,489,033 P3532S possibly damaging Het
Vmn2r6 T C 3: 64,556,472 I314V probably benign Het
Wdr66 A G 5: 123,322,454 I1160V probably benign Het
Other mutations in Aga
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Aga APN 8 53518921 missense probably benign
IGL02581:Aga APN 8 53521044 splice site probably benign
IGL02617:Aga APN 8 53520313 missense possibly damaging 0.66
IGL03008:Aga APN 8 53511826 missense probably benign
R2099:Aga UTSW 8 53521131 nonsense probably null
R3747:Aga UTSW 8 53517821 missense probably benign
R4247:Aga UTSW 8 53511830 missense possibly damaging 0.72
R4399:Aga UTSW 8 53511826 missense probably benign
R4421:Aga UTSW 8 53511826 missense probably benign
R4475:Aga UTSW 8 53511836 missense probably damaging 0.98
R5235:Aga UTSW 8 53514326 missense probably damaging 1.00
R5640:Aga UTSW 8 53511884 missense probably damaging 1.00
R7748:Aga UTSW 8 53511805 start codon destroyed possibly damaging 0.79
X0027:Aga UTSW 8 53521156 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTCTACCATGAAGACAGGAAGG -3'
(R):5'- TCGTGGCATTGATCAGAAATCC -3'

Sequencing Primer
(F):5'- CAGGAAGGGCAAAATATATACACAC -3'
(R):5'- TTCATTCTCAAGTGGTAAACTGAC -3'
Posted On2015-04-29