Incidental Mutation 'R4018:Maml1'
ID312023
Institutional Source Beutler Lab
Gene Symbol Maml1
Ensembl Gene ENSMUSG00000050567
Gene Namemastermind like transcriptional coactivator 1
SynonymsD930008C07Rik, Mam-1
MMRRC Submission 040848-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4018 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location50255634-50292311 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 50265784 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 521 (N521K)
Ref Sequence ENSEMBL: ENSMUSP00000059210 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059458]
Predicted Effect probably damaging
Transcript: ENSMUST00000059458
AA Change: N521K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000059210
Gene: ENSMUSG00000050567
AA Change: N521K

DomainStartEndE-ValueType
MamL-1 14 73 1.04e-32 SMART
low complexity region 77 102 N/A INTRINSIC
low complexity region 280 291 N/A INTRINSIC
low complexity region 373 383 N/A INTRINSIC
low complexity region 419 435 N/A INTRINSIC
low complexity region 588 600 N/A INTRINSIC
coiled coil region 627 671 N/A INTRINSIC
low complexity region 911 930 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000135868
AA Change: N435K
SMART Domains Protein: ENSMUSP00000118188
Gene: ENSMUSG00000050567
AA Change: N435K

DomainStartEndE-ValueType
low complexity region 1 17 N/A INTRINSIC
low complexity region 195 206 N/A INTRINSIC
low complexity region 288 298 N/A INTRINSIC
low complexity region 334 350 N/A INTRINSIC
low complexity region 503 515 N/A INTRINSIC
coiled coil region 541 565 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180443
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222498
Meta Mutation Damage Score 0.2489 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 92.4%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein is the human homolog of mastermind, a Drosophila protein that plays a role in the Notch signaling pathway involved in cell-fate determination. There is in vitro evidence that the human homolog forms a complex with the intracellular portion of human Notch receptors and can increase expression of a Notch-induced gene. This evidence supports its proposed function as a transcriptional co-activator in the Notch signaling pathway. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display postnatal lethality, reduced size, and skeletal muscle degeneration and necrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aga A G 8: 53,523,191 K319R probably benign Het
Brip1 G T 11: 86,138,851 T619K possibly damaging Het
Cd300ld2 G T 11: 115,012,504 probably benign Het
Cd300lg A G 11: 102,041,594 R2G probably damaging Het
Celsr2 C T 3: 108,394,965 V2616I possibly damaging Het
Edem3 C T 1: 151,804,826 probably benign Het
Endou T A 15: 97,718,937 K235M probably damaging Het
Gm5431 T A 11: 48,889,168 N309I probably damaging Het
Il4 T A 11: 53,613,979 probably benign Het
Iws1 C A 18: 32,070,152 S27* probably null Het
Kdm5d T C Y: 910,441 probably benign Het
Ldb3 T C 14: 34,552,171 probably benign Het
Llgl2 A G 11: 115,847,612 T284A probably benign Het
Mlxipl T C 5: 135,132,672 Y482H probably damaging Het
Notch2 G T 3: 98,104,565 C633F probably damaging Het
Oc90 T C 15: 65,887,608 D232G probably benign Het
Olfr1453 T C 19: 13,027,825 E168G probably benign Het
Polr2a T C 11: 69,735,059 Y1717C unknown Het
Prkca T A 11: 107,939,602 I221F probably damaging Het
Rab3c T A 13: 110,084,194 K144N probably damaging Het
Ryr2 T A 13: 11,918,414 N57I probably damaging Het
Scyl3 A G 1: 163,936,499 T145A possibly damaging Het
Sept4 G A 11: 87,585,121 R162Q probably damaging Het
Slc25a39 A T 11: 102,405,024 L127H probably damaging Het
Slc9a9 T C 9: 94,685,163 V95A probably benign Het
Tsc2 T C 17: 24,625,281 I279V probably damaging Het
Usp34 C T 11: 23,489,033 P3532S possibly damaging Het
Vmn2r6 T C 3: 64,556,472 I314V probably benign Het
Wdr66 A G 5: 123,322,454 I1160V probably benign Het
Other mutations in Maml1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Maml1 APN 11 50258714 missense probably damaging 0.97
IGL01326:Maml1 APN 11 50265888 missense probably benign 0.30
IGL01469:Maml1 APN 11 50266526 missense probably damaging 1.00
IGL02336:Maml1 APN 11 50258165 missense probably benign 0.00
IGL02690:Maml1 APN 11 50258630 missense probably damaging 1.00
R0674:Maml1 UTSW 11 50258058 missense probably benign 0.28
R1497:Maml1 UTSW 11 50265707 missense possibly damaging 0.51
R1641:Maml1 UTSW 11 50266947 missense probably benign 0.16
R1888:Maml1 UTSW 11 50266641 missense probably benign 0.00
R1888:Maml1 UTSW 11 50266641 missense probably benign 0.00
R1899:Maml1 UTSW 11 50266130 missense probably damaging 1.00
R2496:Maml1 UTSW 11 50258544 missense probably benign
R3913:Maml1 UTSW 11 50263432 missense probably benign 0.00
R4091:Maml1 UTSW 11 50291829 missense probably benign 0.00
R4202:Maml1 UTSW 11 50257913 missense probably damaging 1.00
R4205:Maml1 UTSW 11 50257913 missense probably damaging 1.00
R4716:Maml1 UTSW 11 50257867 missense probably benign 0.01
R4816:Maml1 UTSW 11 50258335 missense possibly damaging 0.68
R5338:Maml1 UTSW 11 50266951 missense probably benign 0.11
R5460:Maml1 UTSW 11 50266353 missense probably benign 0.36
R6701:Maml1 UTSW 11 50266682 missense probably damaging 1.00
R7336:Maml1 UTSW 11 50266449 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- CAAGTGAAGGGCCTACTCAC -3'
(R):5'- CCTTATCCCATGGAGAAGCC -3'

Sequencing Primer
(F):5'- CCAGGTGGAACCAATGACCG -3'
(R):5'- ATGGAGAAGCCTGCCAGC -3'
Posted On2015-04-29