Mutagenetix > Incidental Mutations

Incidental Mutation 'R4018:Maml1'

312023

Institutional Source

Beutler Lab

Gene Symbol

Maml1

Ensembl Gene

ENSMUSG00000050567

Gene Name

mastermind like transcriptional coactivator 1

Synonyms

D930008C07Rik, Mam-1

MMRRC Submission

040848-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4018 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

50255634-50292311 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 50265784 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 521 (N521K)

Ref Sequence

ENSEMBL: ENSMUSP00000059210 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000059458]

Predicted Effect

probably damaging
Transcript: ENSMUST00000059458
AA Change: N521K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000059210
Gene: ENSMUSG00000050567
AA Change: N521K

Domain	Start	End	E-Value	Type
MamL-1	14	73	1.04e-32	SMART
low complexity region	77	102	N/A	INTRINSIC
low complexity region	280	291	N/A	INTRINSIC
low complexity region	373	383	N/A	INTRINSIC
low complexity region	419	435	N/A	INTRINSIC
low complexity region	588	600	N/A	INTRINSIC
coiled coil region	627	671	N/A	INTRINSIC
low complexity region	911	930	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000135868
AA Change: N435K

SMART Domains

Protein: ENSMUSP00000118188
Gene: ENSMUSG00000050567
AA Change: N435K

Domain	Start	End	E-Value	Type
low complexity region	1	17	N/A	INTRINSIC
low complexity region	195	206	N/A	INTRINSIC
low complexity region	288	298	N/A	INTRINSIC
low complexity region	334	350	N/A	INTRINSIC
low complexity region	503	515	N/A	INTRINSIC
coiled coil region	541	565	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000180443

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222498

Meta Mutation Damage Score

0.2489

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 92.4%

Validation Efficiency

100% (33/33)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein is the human homolog of mastermind, a Drosophila protein that plays a role in the Notch signaling pathway involved in cell-fate determination. There is in vitro evidence that the human homolog forms a complex with the intracellular portion of human Notch receptors and can increase expression of a Notch-induced gene. This evidence supports its proposed function as a transcriptional co-activator in the Notch signaling pathway. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display postnatal lethality, reduced size, and skeletal muscle degeneration and necrosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 29 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aga	A	G	8: 53,523,191	K319R	probably benign	Het
Brip1	G	T	11: 86,138,851	T619K	possibly damaging	Het
Cd300ld2	G	T	11: 115,012,504		probably benign	Het
Cd300lg	A	G	11: 102,041,594	R2G	probably damaging	Het
Celsr2	C	T	3: 108,394,965	V2616I	possibly damaging	Het
Edem3	C	T	1: 151,804,826		probably benign	Het
Endou	T	A	15: 97,718,937	K235M	probably damaging	Het
Gm5431	T	A	11: 48,889,168	N309I	probably damaging	Het
Il4	T	A	11: 53,613,979		probably benign	Het
Iws1	C	A	18: 32,070,152	S27*	probably null	Het
Kdm5d	T	C	Y: 910,441		probably benign	Het
Ldb3	T	C	14: 34,552,171		probably benign	Het
Llgl2	A	G	11: 115,847,612	T284A	probably benign	Het
Mlxipl	T	C	5: 135,132,672	Y482H	probably damaging	Het
Notch2	G	T	3: 98,104,565	C633F	probably damaging	Het
Oc90	T	C	15: 65,887,608	D232G	probably benign	Het
Olfr1453	T	C	19: 13,027,825	E168G	probably benign	Het
Polr2a	T	C	11: 69,735,059	Y1717C	unknown	Het
Prkca	T	A	11: 107,939,602	I221F	probably damaging	Het
Rab3c	T	A	13: 110,084,194	K144N	probably damaging	Het
Ryr2	T	A	13: 11,918,414	N57I	probably damaging	Het
Scyl3	A	G	1: 163,936,499	T145A	possibly damaging	Het
Sept4	G	A	11: 87,585,121	R162Q	probably damaging	Het
Slc25a39	A	T	11: 102,405,024	L127H	probably damaging	Het
Slc9a9	T	C	9: 94,685,163	V95A	probably benign	Het
Tsc2	T	C	17: 24,625,281	I279V	probably damaging	Het
Usp34	C	T	11: 23,489,033	P3532S	possibly damaging	Het
Vmn2r6	T	C	3: 64,556,472	I314V	probably benign	Het
Wdr66	A	G	5: 123,322,454	I1160V	probably benign	Het

Other mutations in Maml1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00943:Maml1	APN	11	50258714	missense	probably damaging	0.97
IGL01326:Maml1	APN	11	50265888	missense	probably benign	0.30
IGL01469:Maml1	APN	11	50266526	missense	probably damaging	1.00
IGL02336:Maml1	APN	11	50258165	missense	probably benign	0.00
IGL02690:Maml1	APN	11	50258630	missense	probably damaging	1.00
R0674:Maml1	UTSW	11	50258058	missense	probably benign	0.28
R1497:Maml1	UTSW	11	50265707	missense	possibly damaging	0.51
R1641:Maml1	UTSW	11	50266947	missense	probably benign	0.16
R1888:Maml1	UTSW	11	50266641	missense	probably benign	0.00
R1888:Maml1	UTSW	11	50266641	missense	probably benign	0.00
R1899:Maml1	UTSW	11	50266130	missense	probably damaging	1.00
R2496:Maml1	UTSW	11	50258544	missense	probably benign
R3913:Maml1	UTSW	11	50263432	missense	probably benign	0.00
R4091:Maml1	UTSW	11	50291829	missense	probably benign	0.00
R4202:Maml1	UTSW	11	50257913	missense	probably damaging	1.00
R4205:Maml1	UTSW	11	50257913	missense	probably damaging	1.00
R4716:Maml1	UTSW	11	50257867	missense	probably benign	0.01
R4816:Maml1	UTSW	11	50258335	missense	possibly damaging	0.68
R5338:Maml1	UTSW	11	50266951	missense	probably benign	0.11
R5460:Maml1	UTSW	11	50266353	missense	probably benign	0.36
R6701:Maml1	UTSW	11	50266682	missense	probably damaging	1.00
R7336:Maml1	UTSW	11	50266449	missense	possibly damaging	0.77

Predicted Primers

PCR Primer
(F):5'- CAAGTGAAGGGCCTACTCAC -3'
(R):5'- CCTTATCCCATGGAGAAGCC -3'

Sequencing Primer
(F):5'- CCAGGTGGAACCAATGACCG -3'
(R):5'- ATGGAGAAGCCTGCCAGC -3'

Posted On

2015-04-29