Incidental Mutation 'R4018:Sept4'
ID312026
Institutional Source Beutler Lab
Gene Symbol Sept4
Ensembl Gene ENSMUSG00000020486
Gene Nameseptin 4
Synonymscell division control-related protein 2b, ARTS, Pnutl2, septin H5, Bh5
MMRRC Submission 040848-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.683) question?
Stock #R4018 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location87568903-87590539 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 87585121 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 162 (R162Q)
Ref Sequence ENSEMBL: ENSMUSP00000103596 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018544] [ENSMUST00000063156] [ENSMUST00000107960] [ENSMUST00000107961] [ENSMUST00000107962] [ENSMUST00000122067] [ENSMUST00000122945] [ENSMUST00000133202]
Predicted Effect probably damaging
Transcript: ENSMUST00000018544
AA Change: R181Q

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000018544
Gene: ENSMUSG00000020486
AA Change: R181Q

DomainStartEndE-ValueType
low complexity region 94 108 N/A INTRINSIC
Pfam:Septin 141 421 1.8e-130 PFAM
Pfam:MMR_HSR1 146 290 1.3e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000063156
AA Change: R82Q

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000060127
Gene: ENSMUSG00000020486
AA Change: R82Q

DomainStartEndE-ValueType
Pfam:DUF258 26 142 7.5e-7 PFAM
Pfam:Septin 42 322 7.5e-131 PFAM
Pfam:MMR_HSR1 47 211 5.4e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107960
AA Change: R181Q

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103594
Gene: ENSMUSG00000020486
AA Change: R181Q

DomainStartEndE-ValueType
low complexity region 94 108 N/A INTRINSIC
Pfam:Septin 141 421 1.1e-130 PFAM
Pfam:MMR_HSR1 146 293 7.3e-7 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000107961
AA Change: R75Q

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103595
Gene: ENSMUSG00000020486
AA Change: R75Q

DomainStartEndE-ValueType
Pfam:DUF258 19 135 1e-7 PFAM
Pfam:Septin 35 232 1.9e-89 PFAM
Pfam:MMR_HSR1 40 204 1.2e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107962
AA Change: R162Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103596
Gene: ENSMUSG00000020486
AA Change: R162Q

DomainStartEndE-ValueType
low complexity region 75 89 N/A INTRINSIC
Pfam:Septin 122 402 1.3e-130 PFAM
Pfam:MMR_HSR1 127 273 8.3e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000122067
AA Change: R63Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112960
Gene: ENSMUSG00000020486
AA Change: R63Q

DomainStartEndE-ValueType
Pfam:DUF258 8 124 5.3e-7 PFAM
Pfam:Septin 23 303 3.9e-131 PFAM
Pfam:MMR_HSR1 28 172 4e-7 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000122945
AA Change: R174Q

PolyPhen 2 Score 0.458 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000115682
Gene: ENSMUSG00000020486
AA Change: R174Q

DomainStartEndE-ValueType
low complexity region 87 101 N/A INTRINSIC
Pfam:DUF258 116 212 2.4e-7 PFAM
Pfam:Septin 134 213 9.1e-31 PFAM
Pfam:MMR_HSR1 139 213 5.5e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123081
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127414
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132723
Predicted Effect probably damaging
Transcript: ENSMUST00000133202
AA Change: R171Q

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000115790
Gene: ENSMUSG00000020486
AA Change: R171Q

DomainStartEndE-ValueType
low complexity region 84 98 N/A INTRINSIC
Pfam:DUF258 114 232 1.4e-7 PFAM
Pfam:Septin 131 280 1.2e-72 PFAM
Pfam:MMR_HSR1 136 279 2.2e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133638
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134923
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135175
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140398
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143950
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136229
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148216
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 92.4%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is highly expressed in brain and heart. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. One of the isoforms (known as ARTS) is distinct; it is localized to the mitochondria, and has a role in apoptosis and cancer. [provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygous null males are sterile and have immotile and structurally defective sperm that is bent and lacks the annulus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aga A G 8: 53,523,191 K319R probably benign Het
Brip1 G T 11: 86,138,851 T619K possibly damaging Het
Cd300ld2 G T 11: 115,012,504 probably benign Het
Cd300lg A G 11: 102,041,594 R2G probably damaging Het
Celsr2 C T 3: 108,394,965 V2616I possibly damaging Het
Edem3 C T 1: 151,804,826 probably benign Het
Endou T A 15: 97,718,937 K235M probably damaging Het
Gm5431 T A 11: 48,889,168 N309I probably damaging Het
Il4 T A 11: 53,613,979 probably benign Het
Iws1 C A 18: 32,070,152 S27* probably null Het
Kdm5d T C Y: 910,441 probably benign Het
Ldb3 T C 14: 34,552,171 probably benign Het
Llgl2 A G 11: 115,847,612 T284A probably benign Het
Maml1 A T 11: 50,265,784 N521K probably damaging Het
Mlxipl T C 5: 135,132,672 Y482H probably damaging Het
Notch2 G T 3: 98,104,565 C633F probably damaging Het
Oc90 T C 15: 65,887,608 D232G probably benign Het
Olfr1453 T C 19: 13,027,825 E168G probably benign Het
Polr2a T C 11: 69,735,059 Y1717C unknown Het
Prkca T A 11: 107,939,602 I221F probably damaging Het
Rab3c T A 13: 110,084,194 K144N probably damaging Het
Ryr2 T A 13: 11,918,414 N57I probably damaging Het
Scyl3 A G 1: 163,936,499 T145A possibly damaging Het
Slc25a39 A T 11: 102,405,024 L127H probably damaging Het
Slc9a9 T C 9: 94,685,163 V95A probably benign Het
Tsc2 T C 17: 24,625,281 I279V probably damaging Het
Usp34 C T 11: 23,489,033 P3532S possibly damaging Het
Vmn2r6 T C 3: 64,556,472 I314V probably benign Het
Wdr66 A G 5: 123,322,454 I1160V probably benign Het
Other mutations in Sept4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00941:Sept4 APN 11 87589773 missense probably damaging 1.00
IGL00963:Sept4 APN 11 87583373 missense possibly damaging 0.89
IGL03087:Sept4 APN 11 87585245 splice site probably benign
IGL03268:Sept4 APN 11 87589703 missense probably damaging 0.99
R0077:Sept4 UTSW 11 87581196 missense probably benign
R1729:Sept4 UTSW 11 87583436 missense probably benign 0.26
R1730:Sept4 UTSW 11 87583436 missense probably benign 0.26
R1739:Sept4 UTSW 11 87583436 missense probably benign 0.26
R1762:Sept4 UTSW 11 87583436 missense probably benign 0.26
R1783:Sept4 UTSW 11 87583436 missense probably benign 0.26
R1784:Sept4 UTSW 11 87583436 missense probably benign 0.26
R1785:Sept4 UTSW 11 87583436 missense probably benign 0.26
R1957:Sept4 UTSW 11 87590367 missense probably benign 0.02
R2131:Sept4 UTSW 11 87583436 missense probably benign 0.26
R2133:Sept4 UTSW 11 87583436 missense probably benign 0.26
R2140:Sept4 UTSW 11 87583436 missense probably benign 0.26
R2141:Sept4 UTSW 11 87583436 missense probably benign 0.26
R2252:Sept4 UTSW 11 87589811 missense possibly damaging 0.75
R3696:Sept4 UTSW 11 87585234 missense possibly damaging 0.48
R4193:Sept4 UTSW 11 87583316 critical splice acceptor site probably null
R4196:Sept4 UTSW 11 87588772 missense probably damaging 0.96
R5012:Sept4 UTSW 11 87584404 missense possibly damaging 0.78
R5149:Sept4 UTSW 11 87589245 missense probably damaging 1.00
R5891:Sept4 UTSW 11 87588924 unclassified probably benign
R6090:Sept4 UTSW 11 87589517 missense possibly damaging 0.48
R6145:Sept4 UTSW 11 87585246 splice site probably null
R6257:Sept4 UTSW 11 87590349 missense probably benign 0.07
R6704:Sept4 UTSW 11 87589030 missense probably damaging 1.00
R7064:Sept4 UTSW 11 87590367 missense probably benign 0.02
R7090:Sept4 UTSW 11 87584438 missense probably damaging 1.00
R7784:Sept4 UTSW 11 87579008 missense probably benign
R7790:Sept4 UTSW 11 87589239 missense probably damaging 1.00
R8320:Sept4 UTSW 11 87589734 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- ACCGGCATTTCCTGTGTTGG -3'
(R):5'- ACTATGTCTGTGACCGAATGTG -3'

Sequencing Primer
(F):5'- TCTGGGCAGCAAAGCTA -3'
(R):5'- ACCGAATGTGACCTGTGTAGATGC -3'
Posted On2015-04-29