Mutagenetix > Incidental Mutations

Incidental Mutation 'R4018:Cd300lg'

312027

Institutional Source

Beutler Lab

Gene Symbol

Cd300lg

Ensembl Gene

ENSMUSG00000017309

Gene Name

CD300 molecule like family member G

Synonyms

D11Ertd736e, nepmucin, 2310016B05Rik, Clm9

MMRRC Submission

040848-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4018 (G1)

Quality Score

143

Status

Validated

Chromosome

Chromosomal Location

102041509-102055620 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 102041594 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glycine at position 2 (R2G)

Ref Sequence

ENSEMBL: ENSMUSP00000120921 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000017453] [ENSMUST00000107163] [ENSMUST00000107164] [ENSMUST00000123895]

Predicted Effect

probably damaging
Transcript: ENSMUST00000017453
AA Change: R2G

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000017453
Gene: ENSMUSG00000017309
AA Change: R2G

Domain	Start	End	E-Value	Type
IG	22	124	1.82e-6	SMART
low complexity region	142	155	N/A	INTRINSIC
transmembrane domain	163	185	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000107163
AA Change: R2G

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000102781
Gene: ENSMUSG00000017309
AA Change: R2G

Domain	Start	End	E-Value	Type
IG	22	124	1.82e-6	SMART
internal_repeat_1	154	188	2.12e-12	PROSPERO
internal_repeat_1	180	213	2.12e-12	PROSPERO
low complexity region	226	239	N/A	INTRINSIC
transmembrane domain	247	269	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000107164
AA Change: R2G

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000102782
Gene: ENSMUSG00000017309
AA Change: R2G

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
IG	22	124	1.82e-6	SMART
low complexity region	270	283	N/A	INTRINSIC
transmembrane domain	291	313	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000123895
AA Change: R2G

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000120921
Gene: ENSMUSG00000017309
AA Change: R2G

Domain	Start	End	E-Value	Type
IG	22	124	1.82e-6	SMART
low complexity region	186	199	N/A	INTRINSIC
transmembrane domain	207	229	N/A	INTRINSIC

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 92.4%

Validation Efficiency

100% (33/33)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the CD300 (see MIM 606786)-like (CD300L) family, such as CD300LG, are widely expressed on hematopoietic cells. All CD300L proteins are type I cell surface glycoproteins that contain a single immunoglobulin (Ig) V-like domain (Takatsu et al., 2006 [PubMed 16876123]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Phenotypic analysis of mice homozygous for a targeted allele indicates that this mutation shows no notable phenotype in any parameter tested. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 29 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aga	A	G	8: 53,523,191	K319R	probably benign	Het
Brip1	G	T	11: 86,138,851	T619K	possibly damaging	Het
Cd300ld2	G	T	11: 115,012,504		probably benign	Het
Celsr2	C	T	3: 108,394,965	V2616I	possibly damaging	Het
Edem3	C	T	1: 151,804,826		probably benign	Het
Endou	T	A	15: 97,718,937	K235M	probably damaging	Het
Gm5431	T	A	11: 48,889,168	N309I	probably damaging	Het
Il4	T	A	11: 53,613,979		probably benign	Het
Iws1	C	A	18: 32,070,152	S27*	probably null	Het
Kdm5d	T	C	Y: 910,441		probably benign	Het
Ldb3	T	C	14: 34,552,171		probably benign	Het
Llgl2	A	G	11: 115,847,612	T284A	probably benign	Het
Maml1	A	T	11: 50,265,784	N521K	probably damaging	Het
Mlxipl	T	C	5: 135,132,672	Y482H	probably damaging	Het
Notch2	G	T	3: 98,104,565	C633F	probably damaging	Het
Oc90	T	C	15: 65,887,608	D232G	probably benign	Het
Olfr1453	T	C	19: 13,027,825	E168G	probably benign	Het
Polr2a	T	C	11: 69,735,059	Y1717C	unknown	Het
Prkca	T	A	11: 107,939,602	I221F	probably damaging	Het
Rab3c	T	A	13: 110,084,194	K144N	probably damaging	Het
Ryr2	T	A	13: 11,918,414	N57I	probably damaging	Het
Scyl3	A	G	1: 163,936,499	T145A	possibly damaging	Het
Sept4	G	A	11: 87,585,121	R162Q	probably damaging	Het
Slc25a39	A	T	11: 102,405,024	L127H	probably damaging	Het
Slc9a9	T	C	9: 94,685,163	V95A	probably benign	Het
Tsc2	T	C	17: 24,625,281	I279V	probably damaging	Het
Usp34	C	T	11: 23,489,033	P3532S	possibly damaging	Het
Vmn2r6	T	C	3: 64,556,472	I314V	probably benign	Het
Wdr66	A	G	5: 123,322,454	I1160V	probably benign	Het

Other mutations in Cd300lg

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01125:Cd300lg	APN	11	102054221	unclassified	probably benign
IGL01655:Cd300lg	APN	11	102047075	missense	probably benign	0.41
R0129:Cd300lg	UTSW	11	102054092	critical splice acceptor site	probably null
R0427:Cd300lg	UTSW	11	102043026	missense	probably damaging	0.98
R1401:Cd300lg	UTSW	11	102054155	missense	possibly damaging	0.88
R1533:Cd300lg	UTSW	11	102043221	missense	probably damaging	0.98
R1809:Cd300lg	UTSW	11	102043112	missense	probably benign	0.00
R1848:Cd300lg	UTSW	11	102046206	splice site	probably benign
R1863:Cd300lg	UTSW	11	102041604	missense	probably damaging	0.99
R1918:Cd300lg	UTSW	11	102054110	missense	probably damaging	1.00
R4591:Cd300lg	UTSW	11	102046180	missense	probably benign	0.01
R4758:Cd300lg	UTSW	11	102053591	critical splice donor site	probably null
R6211:Cd300lg	UTSW	11	102054169	missense	possibly damaging	0.50
R6425:Cd300lg	UTSW	11	102046923	missense	probably benign	0.15
R6470:Cd300lg	UTSW	11	102050505	missense	possibly damaging	0.61
R7025:Cd300lg	UTSW	11	102043074	missense	probably damaging	1.00
R7312:Cd300lg	UTSW	11	102046941	missense	probably benign	0.37
R7522:Cd300lg	UTSW	11	102054202	missense	probably benign	0.25
R8074:Cd300lg	UTSW	11	102041601	missense	probably damaging	1.00
R8176:Cd300lg	UTSW	11	102041564	start gained	probably benign

Predicted Primers

PCR Primer
(F):5'- CAACCTGTGGTAACTGGCAC -3'
(R):5'- AGAAAGACCCTGGGCTCAAG -3'

Sequencing Primer
(F):5'- GGTAACTGGCACTGGGTAG -3'
(R):5'- AAGTGCTGAGCTCAGGGC -3'

Posted On

2015-04-29