Incidental Mutation 'R4018:Cd300lg'
ID312027
Institutional Source Beutler Lab
Gene Symbol Cd300lg
Ensembl Gene ENSMUSG00000017309
Gene NameCD300 molecule like family member G
SynonymsD11Ertd736e, nepmucin, 2310016B05Rik, Clm9
MMRRC Submission 040848-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4018 (G1)
Quality Score143
Status Validated
Chromosome11
Chromosomal Location102041509-102055620 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102041594 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 2 (R2G)
Ref Sequence ENSEMBL: ENSMUSP00000120921 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017453] [ENSMUST00000107163] [ENSMUST00000107164] [ENSMUST00000123895]
Predicted Effect probably damaging
Transcript: ENSMUST00000017453
AA Change: R2G

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000017453
Gene: ENSMUSG00000017309
AA Change: R2G

DomainStartEndE-ValueType
IG 22 124 1.82e-6 SMART
low complexity region 142 155 N/A INTRINSIC
transmembrane domain 163 185 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107163
AA Change: R2G

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102781
Gene: ENSMUSG00000017309
AA Change: R2G

DomainStartEndE-ValueType
IG 22 124 1.82e-6 SMART
internal_repeat_1 154 188 2.12e-12 PROSPERO
internal_repeat_1 180 213 2.12e-12 PROSPERO
low complexity region 226 239 N/A INTRINSIC
transmembrane domain 247 269 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107164
AA Change: R2G

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102782
Gene: ENSMUSG00000017309
AA Change: R2G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 22 124 1.82e-6 SMART
low complexity region 270 283 N/A INTRINSIC
transmembrane domain 291 313 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000123895
AA Change: R2G

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000120921
Gene: ENSMUSG00000017309
AA Change: R2G

DomainStartEndE-ValueType
IG 22 124 1.82e-6 SMART
low complexity region 186 199 N/A INTRINSIC
transmembrane domain 207 229 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 92.4%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the CD300 (see MIM 606786)-like (CD300L) family, such as CD300LG, are widely expressed on hematopoietic cells. All CD300L proteins are type I cell surface glycoproteins that contain a single immunoglobulin (Ig) V-like domain (Takatsu et al., 2006 [PubMed 16876123]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Phenotypic analysis of mice homozygous for a targeted allele indicates that this mutation shows no notable phenotype in any parameter tested. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aga A G 8: 53,523,191 K319R probably benign Het
Brip1 G T 11: 86,138,851 T619K possibly damaging Het
Cd300ld2 G T 11: 115,012,504 probably benign Het
Celsr2 C T 3: 108,394,965 V2616I possibly damaging Het
Edem3 C T 1: 151,804,826 probably benign Het
Endou T A 15: 97,718,937 K235M probably damaging Het
Gm5431 T A 11: 48,889,168 N309I probably damaging Het
Il4 T A 11: 53,613,979 probably benign Het
Iws1 C A 18: 32,070,152 S27* probably null Het
Kdm5d T C Y: 910,441 probably benign Het
Ldb3 T C 14: 34,552,171 probably benign Het
Llgl2 A G 11: 115,847,612 T284A probably benign Het
Maml1 A T 11: 50,265,784 N521K probably damaging Het
Mlxipl T C 5: 135,132,672 Y482H probably damaging Het
Notch2 G T 3: 98,104,565 C633F probably damaging Het
Oc90 T C 15: 65,887,608 D232G probably benign Het
Olfr1453 T C 19: 13,027,825 E168G probably benign Het
Polr2a T C 11: 69,735,059 Y1717C unknown Het
Prkca T A 11: 107,939,602 I221F probably damaging Het
Rab3c T A 13: 110,084,194 K144N probably damaging Het
Ryr2 T A 13: 11,918,414 N57I probably damaging Het
Scyl3 A G 1: 163,936,499 T145A possibly damaging Het
Sept4 G A 11: 87,585,121 R162Q probably damaging Het
Slc25a39 A T 11: 102,405,024 L127H probably damaging Het
Slc9a9 T C 9: 94,685,163 V95A probably benign Het
Tsc2 T C 17: 24,625,281 I279V probably damaging Het
Usp34 C T 11: 23,489,033 P3532S possibly damaging Het
Vmn2r6 T C 3: 64,556,472 I314V probably benign Het
Wdr66 A G 5: 123,322,454 I1160V probably benign Het
Other mutations in Cd300lg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01125:Cd300lg APN 11 102054221 unclassified probably benign
IGL01655:Cd300lg APN 11 102047075 missense probably benign 0.41
R0129:Cd300lg UTSW 11 102054092 critical splice acceptor site probably null
R0427:Cd300lg UTSW 11 102043026 missense probably damaging 0.98
R1401:Cd300lg UTSW 11 102054155 missense possibly damaging 0.88
R1533:Cd300lg UTSW 11 102043221 missense probably damaging 0.98
R1809:Cd300lg UTSW 11 102043112 missense probably benign 0.00
R1848:Cd300lg UTSW 11 102046206 splice site probably benign
R1863:Cd300lg UTSW 11 102041604 missense probably damaging 0.99
R1918:Cd300lg UTSW 11 102054110 missense probably damaging 1.00
R4591:Cd300lg UTSW 11 102046180 missense probably benign 0.01
R4758:Cd300lg UTSW 11 102053591 critical splice donor site probably null
R6211:Cd300lg UTSW 11 102054169 missense possibly damaging 0.50
R6425:Cd300lg UTSW 11 102046923 missense probably benign 0.15
R6470:Cd300lg UTSW 11 102050505 missense possibly damaging 0.61
R7025:Cd300lg UTSW 11 102043074 missense probably damaging 1.00
R7312:Cd300lg UTSW 11 102046941 missense probably benign 0.37
R7522:Cd300lg UTSW 11 102054202 missense probably benign 0.25
R8074:Cd300lg UTSW 11 102041601 missense probably damaging 1.00
R8176:Cd300lg UTSW 11 102041564 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CAACCTGTGGTAACTGGCAC -3'
(R):5'- AGAAAGACCCTGGGCTCAAG -3'

Sequencing Primer
(F):5'- GGTAACTGGCACTGGGTAG -3'
(R):5'- AAGTGCTGAGCTCAGGGC -3'
Posted On2015-04-29