Incidental Mutation 'R4018:Slc25a39'
ID312028
Institutional Source Beutler Lab
Gene Symbol Slc25a39
Ensembl Gene ENSMUSG00000018677
Gene Namesolute carrier family 25, member 39
SynonymsD11Ertd333e, 3010027G13Rik
MMRRC Submission 040848-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.900) question?
Stock #R4018 (G1)
Quality Score162
Status Not validated
Chromosome11
Chromosomal Location102402985-102407946 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 102405024 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 127 (L127H)
Ref Sequence ENSEMBL: ENSMUSP00000115445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006750] [ENSMUST00000018821] [ENSMUST00000107098] [ENSMUST00000107102] [ENSMUST00000107103] [ENSMUST00000107105] [ENSMUST00000124755] [ENSMUST00000130436] [ENSMUST00000134669] [ENSMUST00000149777] [ENSMUST00000154001] [ENSMUST00000155104] [ENSMUST00000142097]
Predicted Effect probably benign
Transcript: ENSMUST00000006750
SMART Domains Protein: ENSMUSP00000006750
Gene: ENSMUSG00000006575

DomainStartEndE-ValueType
RUN 125 187 2.34e-19 SMART
coiled coil region 267 322 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000018821
AA Change: L127H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000018821
Gene: ENSMUSG00000018677
AA Change: L127H

DomainStartEndE-ValueType
Pfam:Mito_carr 7 156 6.9e-23 PFAM
Pfam:Mito_carr 158 247 6.1e-19 PFAM
Pfam:Mito_carr 251 352 1.1e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107098
AA Change: L119H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102715
Gene: ENSMUSG00000018677
AA Change: L119H

DomainStartEndE-ValueType
Pfam:Mito_carr 7 148 1.4e-21 PFAM
Pfam:Mito_carr 150 240 3.7e-19 PFAM
Pfam:Mito_carr 243 344 4.6e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107102
SMART Domains Protein: ENSMUSP00000102719
Gene: ENSMUSG00000006575

DomainStartEndE-ValueType
RUN 125 187 2.34e-19 SMART
coiled coil region 267 322 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107103
SMART Domains Protein: ENSMUSP00000102720
Gene: ENSMUSG00000006575

DomainStartEndE-ValueType
RUN 120 182 2.34e-19 SMART
coiled coil region 262 317 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107105
SMART Domains Protein: ENSMUSP00000102722
Gene: ENSMUSG00000006575

DomainStartEndE-ValueType
RUN 125 187 2.34e-19 SMART
coiled coil region 267 320 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123688
Predicted Effect probably damaging
Transcript: ENSMUST00000124755
AA Change: L127H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120021
Gene: ENSMUSG00000018677
AA Change: L127H

DomainStartEndE-ValueType
Pfam:Mito_carr 7 71 1.3e-9 PFAM
Pfam:Mito_carr 92 152 9.7e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128825
SMART Domains Protein: ENSMUSP00000121790
Gene: ENSMUSG00000018677

DomainStartEndE-ValueType
Pfam:Mito_carr 35 77 6.5e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000130436
AA Change: L127H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115087
Gene: ENSMUSG00000018677
AA Change: L127H

DomainStartEndE-ValueType
Pfam:Mito_carr 7 70 1.8e-9 PFAM
Pfam:Mito_carr 92 156 5.7e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131219
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132876
Predicted Effect probably benign
Transcript: ENSMUST00000134669
SMART Domains Protein: ENSMUSP00000114481
Gene: ENSMUSG00000018677

DomainStartEndE-ValueType
Pfam:Mito_carr 7 69 1.9e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000149777
AA Change: L127H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115365
Gene: ENSMUSG00000018677
AA Change: L127H

DomainStartEndE-ValueType
Pfam:Mito_carr 7 70 2.7e-9 PFAM
Pfam:Mito_carr 92 156 8.7e-15 PFAM
Pfam:Mito_carr 158 220 6.5e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153395
Predicted Effect probably damaging
Transcript: ENSMUST00000154001
AA Change: L127H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116336
Gene: ENSMUSG00000018677
AA Change: L127H

DomainStartEndE-ValueType
Pfam:Mito_carr 7 70 3.1e-10 PFAM
Pfam:Mito_carr 92 156 9.8e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000155104
AA Change: L127H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115445
Gene: ENSMUSG00000018677
AA Change: L127H

DomainStartEndE-ValueType
Pfam:Mito_carr 7 69 3.7e-9 PFAM
Pfam:Mito_carr 92 156 1.2e-14 PFAM
Pfam:Mito_carr 158 248 5.4e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147160
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147860
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141535
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142157
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150982
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146330
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183859
Predicted Effect probably benign
Transcript: ENSMUST00000142097
SMART Domains Protein: ENSMUSP00000114365
Gene: ENSMUSG00000018677

DomainStartEndE-ValueType
Pfam:Mito_carr 7 63 2e-10 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 92.4%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SLC25 transporter or mitochondrial carrier family of proteins. Members of this family are encoded by the nuclear genome while their protein products are usually embedded in the inner mitochondrial membrane and exhibit wide-ranging substrate specificity. Although the encoded protein is currently considered an orphan transporter, this protein is related to other carriers known to transport amino acids. This protein may play a role in iron homeostasis. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aga A G 8: 53,523,191 K319R probably benign Het
Brip1 G T 11: 86,138,851 T619K possibly damaging Het
Cd300ld2 G T 11: 115,012,504 probably benign Het
Cd300lg A G 11: 102,041,594 R2G probably damaging Het
Celsr2 C T 3: 108,394,965 V2616I possibly damaging Het
Edem3 C T 1: 151,804,826 probably benign Het
Endou T A 15: 97,718,937 K235M probably damaging Het
Gm5431 T A 11: 48,889,168 N309I probably damaging Het
Il4 T A 11: 53,613,979 probably benign Het
Iws1 C A 18: 32,070,152 S27* probably null Het
Kdm5d T C Y: 910,441 probably benign Het
Ldb3 T C 14: 34,552,171 probably benign Het
Llgl2 A G 11: 115,847,612 T284A probably benign Het
Maml1 A T 11: 50,265,784 N521K probably damaging Het
Mlxipl T C 5: 135,132,672 Y482H probably damaging Het
Notch2 G T 3: 98,104,565 C633F probably damaging Het
Oc90 T C 15: 65,887,608 D232G probably benign Het
Olfr1453 T C 19: 13,027,825 E168G probably benign Het
Polr2a T C 11: 69,735,059 Y1717C unknown Het
Prkca T A 11: 107,939,602 I221F probably damaging Het
Rab3c T A 13: 110,084,194 K144N probably damaging Het
Ryr2 T A 13: 11,918,414 N57I probably damaging Het
Scyl3 A G 1: 163,936,499 T145A possibly damaging Het
Sept4 G A 11: 87,585,121 R162Q probably damaging Het
Slc9a9 T C 9: 94,685,163 V95A probably benign Het
Tsc2 T C 17: 24,625,281 I279V probably damaging Het
Usp34 C T 11: 23,489,033 P3532S possibly damaging Het
Vmn2r6 T C 3: 64,556,472 I314V probably benign Het
Wdr66 A G 5: 123,322,454 I1160V probably benign Het
Other mutations in Slc25a39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01451:Slc25a39 APN 11 102404900 missense probably damaging 1.00
IGL01601:Slc25a39 APN 11 102405718 missense probably damaging 1.00
IGL02734:Slc25a39 APN 11 102404523 missense probably benign 0.03
IGL03382:Slc25a39 APN 11 102406204 critical splice donor site probably null
R0218:Slc25a39 UTSW 11 102406230 missense probably benign 0.00
R0359:Slc25a39 UTSW 11 102406569 missense possibly damaging 0.88
R0939:Slc25a39 UTSW 11 102405051 missense probably damaging 1.00
R1702:Slc25a39 UTSW 11 102406626 missense possibly damaging 0.68
R2047:Slc25a39 UTSW 11 102405831 splice site probably benign
R2367:Slc25a39 UTSW 11 102403651 missense possibly damaging 0.52
R4755:Slc25a39 UTSW 11 102406666 start gained probably benign
R4878:Slc25a39 UTSW 11 102403675 missense probably benign 0.06
R5629:Slc25a39 UTSW 11 102404893 nonsense probably null
R5704:Slc25a39 UTSW 11 102403394 unclassified probably benign
R6092:Slc25a39 UTSW 11 102404893 nonsense probably null
R6502:Slc25a39 UTSW 11 102404460 missense probably damaging 0.99
R6955:Slc25a39 UTSW 11 102403518 missense probably benign 0.00
R6980:Slc25a39 UTSW 11 102405775 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCAAGGACTGACCACACAGG -3'
(R):5'- CACCTAGAACCAAGTTGGGG -3'

Sequencing Primer
(F):5'- TGACCACACAGGAAGGCCTTG -3'
(R):5'- GTGAGTGTAGAGCTAACTGGC -3'
Posted On2015-04-29