Incidental Mutation 'R4018:Cd300ld2'
ID312030
Institutional Source Beutler Lab
Gene Symbol Cd300ld2
Ensembl Gene ENSMUSG00000089753
Gene NameCD300 molecule like family member D2
SynonymsGm11709
MMRRC Submission 040848-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4018 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location115010335-115016193 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to T at 115012504 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000090120 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092463] [ENSMUST00000106578]
Predicted Effect probably benign
Transcript: ENSMUST00000092463
SMART Domains Protein: ENSMUSP00000090120
Gene: ENSMUSG00000089753

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 25 124 2.11e-2 SMART
Predicted Effect unknown
Transcript: ENSMUST00000106578
AA Change: P172T
SMART Domains Protein: ENSMUSP00000102188
Gene: ENSMUSG00000089753
AA Change: P172T

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 25 124 2.11e-2 SMART
low complexity region 131 201 N/A INTRINSIC
low complexity region 202 222 N/A INTRINSIC
transmembrane domain 240 262 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 92.4%
Validation Efficiency 100% (33/33)
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aga A G 8: 53,523,191 K319R probably benign Het
Brip1 G T 11: 86,138,851 T619K possibly damaging Het
Cd300lg A G 11: 102,041,594 R2G probably damaging Het
Celsr2 C T 3: 108,394,965 V2616I possibly damaging Het
Edem3 C T 1: 151,804,826 probably benign Het
Endou T A 15: 97,718,937 K235M probably damaging Het
Gm5431 T A 11: 48,889,168 N309I probably damaging Het
Il4 T A 11: 53,613,979 probably benign Het
Iws1 C A 18: 32,070,152 S27* probably null Het
Kdm5d T C Y: 910,441 probably benign Het
Ldb3 T C 14: 34,552,171 probably benign Het
Llgl2 A G 11: 115,847,612 T284A probably benign Het
Maml1 A T 11: 50,265,784 N521K probably damaging Het
Mlxipl T C 5: 135,132,672 Y482H probably damaging Het
Notch2 G T 3: 98,104,565 C633F probably damaging Het
Oc90 T C 15: 65,887,608 D232G probably benign Het
Olfr1453 T C 19: 13,027,825 E168G probably benign Het
Polr2a T C 11: 69,735,059 Y1717C unknown Het
Prkca T A 11: 107,939,602 I221F probably damaging Het
Rab3c T A 13: 110,084,194 K144N probably damaging Het
Ryr2 T A 13: 11,918,414 N57I probably damaging Het
Scyl3 A G 1: 163,936,499 T145A possibly damaging Het
Sept4 G A 11: 87,585,121 R162Q probably damaging Het
Slc25a39 A T 11: 102,405,024 L127H probably damaging Het
Slc9a9 T C 9: 94,685,163 V95A probably benign Het
Tsc2 T C 17: 24,625,281 I279V probably damaging Het
Usp34 C T 11: 23,489,033 P3532S possibly damaging Het
Vmn2r6 T C 3: 64,556,472 I314V probably benign Het
Wdr66 A G 5: 123,322,454 I1160V probably benign Het
Other mutations in Cd300ld2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01012:Cd300ld2 APN 11 115012297 missense probably benign 0.23
IGL01450:Cd300ld2 APN 11 115012543 unclassified probably benign
IGL01452:Cd300ld2 APN 11 115012602 unclassified probably benign
IGL02086:Cd300ld2 APN 11 115012558 unclassified probably benign
IGL02111:Cd300ld2 APN 11 115012393 unclassified probably benign
IGL02505:Cd300ld2 APN 11 115013687 missense probably benign 0.11
IGL02517:Cd300ld2 APN 11 115010423 missense possibly damaging 0.53
IGL02836:Cd300ld2 APN 11 115013750 missense probably benign 0.07
IGL03081:Cd300ld2 APN 11 115012542 unclassified probably benign
PIT4486001:Cd300ld2 UTSW 11 115012431 small deletion probably benign
R0579:Cd300ld2 UTSW 11 115012299 missense probably benign 0.23
R1065:Cd300ld2 UTSW 11 115013760 missense probably damaging 1.00
R1393:Cd300ld2 UTSW 11 115012578 unclassified probably benign
R1481:Cd300ld2 UTSW 11 115012633 missense probably benign 0.36
R1583:Cd300ld2 UTSW 11 115013777 missense probably benign 0.06
R1755:Cd300ld2 UTSW 11 115013775 missense probably benign 0.01
R1865:Cd300ld2 UTSW 11 115012618 unclassified probably benign
R5516:Cd300ld2 UTSW 11 115012444 unclassified probably benign
R6065:Cd300ld2 UTSW 11 115012602 unclassified probably benign
R6927:Cd300ld2 UTSW 11 115013793 missense probably damaging 1.00
R7874:Cd300ld2 UTSW 11 115012431 small deletion probably benign
R7883:Cd300ld2 UTSW 11 115012431 small deletion probably benign
R8044:Cd300ld2 UTSW 11 115013719 nonsense probably null
R8263:Cd300ld2 UTSW 11 115012366 missense unknown
R8306:Cd300ld2 UTSW 11 115013822 missense probably benign 0.04
R8424:Cd300ld2 UTSW 11 115012431 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- TGCCAATGCTCTCCATGGTTG -3'
(R):5'- TCGAGCTCCTTAATTCCTAGGG -3'

Sequencing Primer
(F):5'- CAATGCTCTCCATGGTTGGTGTTG -3'
(R):5'- TTCCTAGGGAAAGAACTTTAGGCC -3'
Posted On2015-04-29