Incidental Mutation 'R4018:Rab3c'
ID312034
Institutional Source Beutler Lab
Gene Symbol Rab3c
Ensembl Gene ENSMUSG00000021700
Gene NameRAB3C, member RAS oncogene family
Synonyms
MMRRC Submission 040848-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4018 (G1)
Quality Score213
Status Validated
Chromosome13
Chromosomal Location110054187-110280996 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 110084194 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 144 (K144N)
Ref Sequence ENSEMBL: ENSMUSP00000153136 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167824] [ENSMUST00000223922] [ENSMUST00000224180]
Predicted Effect probably damaging
Transcript: ENSMUST00000167824
AA Change: K144N

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000132945
Gene: ENSMUSG00000021700
AA Change: K144N

DomainStartEndE-ValueType
RAB 31 194 1.35e-93 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000223922
AA Change: K142N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000224180
AA Change: K144N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 92.4%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the RAS oncogene family and encodes a small GTPase. Other similar small GTPases are known to be involved in vesicle trafficking, and the encoded protein was shown to play a role in recycling phagocytosed MHC class 1 complexes to the cell surface. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aga A G 8: 53,523,191 K319R probably benign Het
Brip1 G T 11: 86,138,851 T619K possibly damaging Het
Cd300ld2 G T 11: 115,012,504 probably benign Het
Cd300lg A G 11: 102,041,594 R2G probably damaging Het
Celsr2 C T 3: 108,394,965 V2616I possibly damaging Het
Edem3 C T 1: 151,804,826 probably benign Het
Endou T A 15: 97,718,937 K235M probably damaging Het
Gm5431 T A 11: 48,889,168 N309I probably damaging Het
Il4 T A 11: 53,613,979 probably benign Het
Iws1 C A 18: 32,070,152 S27* probably null Het
Kdm5d T C Y: 910,441 probably benign Het
Ldb3 T C 14: 34,552,171 probably benign Het
Llgl2 A G 11: 115,847,612 T284A probably benign Het
Maml1 A T 11: 50,265,784 N521K probably damaging Het
Mlxipl T C 5: 135,132,672 Y482H probably damaging Het
Notch2 G T 3: 98,104,565 C633F probably damaging Het
Oc90 T C 15: 65,887,608 D232G probably benign Het
Olfr1453 T C 19: 13,027,825 E168G probably benign Het
Polr2a T C 11: 69,735,059 Y1717C unknown Het
Prkca T A 11: 107,939,602 I221F probably damaging Het
Ryr2 T A 13: 11,918,414 N57I probably damaging Het
Scyl3 A G 1: 163,936,499 T145A possibly damaging Het
Sept4 G A 11: 87,585,121 R162Q probably damaging Het
Slc25a39 A T 11: 102,405,024 L127H probably damaging Het
Slc9a9 T C 9: 94,685,163 V95A probably benign Het
Tsc2 T C 17: 24,625,281 I279V probably damaging Het
Usp34 C T 11: 23,489,033 P3532S possibly damaging Het
Vmn2r6 T C 3: 64,556,472 I314V probably benign Het
Wdr66 A G 5: 123,322,454 I1160V probably benign Het
Other mutations in Rab3c
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1294:Rab3c UTSW 13 110260565 missense possibly damaging 0.72
R1346:Rab3c UTSW 13 110260586 missense probably damaging 1.00
R1819:Rab3c UTSW 13 110084135 missense possibly damaging 0.52
R1903:Rab3c UTSW 13 110084210 missense probably damaging 1.00
R2059:Rab3c UTSW 13 110260516 missense probably damaging 1.00
R4707:Rab3c UTSW 13 110061900 missense probably benign 0.00
R4784:Rab3c UTSW 13 110061900 missense probably benign 0.00
R4785:Rab3c UTSW 13 110061900 missense probably benign 0.00
R5305:Rab3c UTSW 13 110181077 missense probably damaging 1.00
R5358:Rab3c UTSW 13 110061963 missense possibly damaging 0.77
R8136:Rab3c UTSW 13 110181020 nonsense probably null
Z1177:Rab3c UTSW 13 110260486 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGGGTTTGCAGAAGGTC -3'
(R):5'- AAGTGTCTGACTGGGCTTCG -3'

Sequencing Primer
(F):5'- TGCGTACATACCACACACATG -3'
(R):5'- GGTCAACTCAGATCAAAACA -3'
Posted On2015-04-29