Mutagenetix > Incidental Mutations

Incidental Mutation 'R4018:Endou'

312039

Institutional Source

Beutler Lab

Gene Symbol

Endou

Ensembl Gene

ENSMUSG00000022468

Gene Name

endonuclease, polyU-specific

Synonyms

Tcl-30, Pp11r

MMRRC Submission

040848-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4018 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

97711015-97731339 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 97718937 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Methionine at position 235 (K235M)

Ref Sequence

ENSEMBL: ENSMUSP00000023105 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023105] [ENSMUST00000100249] [ENSMUST00000230430]

Predicted Effect

probably damaging
Transcript: ENSMUST00000023105
AA Change: K235M

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000023105
Gene: ENSMUSG00000022468
AA Change: K235M

Domain	Start	End	E-Value	Type
transmembrane domain	13	35	N/A	INTRINSIC
SO	127	169	1.93e-11	SMART
Pfam:XendoU	181	448	1.4e-100	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000100249
AA Change: K193M

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000097820
Gene: ENSMUSG00000022468
AA Change: K193M

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
SO	20	62	8.61e-9	SMART
SO	85	127	1.93e-11	SMART
Pfam:XendoU	136	407	2.8e-99	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000230430

Meta Mutation Damage Score

0.2644

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 92.4%

Validation Efficiency

100% (33/33)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with protease activity and is expressed in the placenta. The protein may be useful as a tumor marker. Multiple alternatively spliced transcript variants have been found for this protein. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal splenic B cell numbers and activation-induced B cell apoptosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 29 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aga	A	G	8: 53,523,191	K319R	probably benign	Het
Brip1	G	T	11: 86,138,851	T619K	possibly damaging	Het
Cd300ld2	G	T	11: 115,012,504		probably benign	Het
Cd300lg	A	G	11: 102,041,594	R2G	probably damaging	Het
Celsr2	C	T	3: 108,394,965	V2616I	possibly damaging	Het
Edem3	C	T	1: 151,804,826		probably benign	Het
Gm5431	T	A	11: 48,889,168	N309I	probably damaging	Het
Il4	T	A	11: 53,613,979		probably benign	Het
Iws1	C	A	18: 32,070,152	S27*	probably null	Het
Kdm5d	T	C	Y: 910,441		probably benign	Het
Ldb3	T	C	14: 34,552,171		probably benign	Het
Llgl2	A	G	11: 115,847,612	T284A	probably benign	Het
Maml1	A	T	11: 50,265,784	N521K	probably damaging	Het
Mlxipl	T	C	5: 135,132,672	Y482H	probably damaging	Het
Notch2	G	T	3: 98,104,565	C633F	probably damaging	Het
Oc90	T	C	15: 65,887,608	D232G	probably benign	Het
Olfr1453	T	C	19: 13,027,825	E168G	probably benign	Het
Polr2a	T	C	11: 69,735,059	Y1717C	unknown	Het
Prkca	T	A	11: 107,939,602	I221F	probably damaging	Het
Rab3c	T	A	13: 110,084,194	K144N	probably damaging	Het
Ryr2	T	A	13: 11,918,414	N57I	probably damaging	Het
Scyl3	A	G	1: 163,936,499	T145A	possibly damaging	Het
Sept4	G	A	11: 87,585,121	R162Q	probably damaging	Het
Slc25a39	A	T	11: 102,405,024	L127H	probably damaging	Het
Slc9a9	T	C	9: 94,685,163	V95A	probably benign	Het
Tsc2	T	C	17: 24,625,281	I279V	probably damaging	Het
Usp34	C	T	11: 23,489,033	P3532S	possibly damaging	Het
Vmn2r6	T	C	3: 64,556,472	I314V	probably benign	Het
Wdr66	A	G	5: 123,322,454	I1160V	probably benign	Het

Other mutations in Endou

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R0364:Endou	UTSW	15	97718973	splice site	probably benign
R1134:Endou	UTSW	15	97713866	missense	probably damaging	1.00
R1418:Endou	UTSW	15	97718973	splice site	probably benign
R1896:Endou	UTSW	15	97712992	missense	probably damaging	1.00
R2960:Endou	UTSW	15	97713806	missense	probably damaging	1.00
R4618:Endou	UTSW	15	97713882	missense	possibly damaging	0.67
R4754:Endou	UTSW	15	97726539	missense	probably damaging	0.99
R4807:Endou	UTSW	15	97731232	missense	probably benign	0.01
R4997:Endou	UTSW	15	97719577	missense	probably damaging	1.00
R5321:Endou	UTSW	15	97721032	missense	probably damaging	0.99
R5470:Endou	UTSW	15	97718955	missense	probably damaging	1.00
R5604:Endou	UTSW	15	97720919	missense	probably benign	0.00
R5764:Endou	UTSW	15	97714607	missense	probably damaging	1.00
R6114:Endou	UTSW	15	97713876	nonsense	probably null
R6404:Endou	UTSW	15	97712131	missense	probably damaging	1.00
R6528:Endou	UTSW	15	97719629	missense	probably damaging	1.00
R7089:Endou	UTSW	15	97720245	missense	probably benign	0.01
R7103:Endou	UTSW	15	97718929	missense	probably damaging	1.00
R7382:Endou	UTSW	15	97718926	nonsense	probably null
R7707:Endou	UTSW	15	97713102	critical splice acceptor site	probably null
R7759:Endou	UTSW	15	97713866	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCACTTTGGTGATGGAGAAAGC -3'
(R):5'- ACAGACCTCAGAGTTGGCTG -3'

Sequencing Primer
(F):5'- AGCTATAGAGTTCCTTCATGACAGCC -3'
(R):5'- GCCTGGTCTACGAAGTAAATTCCAG -3'

Posted On

2015-04-29