Incidental Mutation 'R4018:Endou'
ID312039
Institutional Source Beutler Lab
Gene Symbol Endou
Ensembl Gene ENSMUSG00000022468
Gene Nameendonuclease, polyU-specific
SynonymsTcl-30, Pp11r
MMRRC Submission 040848-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4018 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location97711015-97731339 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 97718937 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Methionine at position 235 (K235M)
Ref Sequence ENSEMBL: ENSMUSP00000023105 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023105] [ENSMUST00000100249] [ENSMUST00000230430]
Predicted Effect probably damaging
Transcript: ENSMUST00000023105
AA Change: K235M

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000023105
Gene: ENSMUSG00000022468
AA Change: K235M

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
SO 127 169 1.93e-11 SMART
Pfam:XendoU 181 448 1.4e-100 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100249
AA Change: K193M

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097820
Gene: ENSMUSG00000022468
AA Change: K193M

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
SO 20 62 8.61e-9 SMART
SO 85 127 1.93e-11 SMART
Pfam:XendoU 136 407 2.8e-99 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000230430
Meta Mutation Damage Score 0.2644 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 92.4%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with protease activity and is expressed in the placenta. The protein may be useful as a tumor marker. Multiple alternatively spliced transcript variants have been found for this protein. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal splenic B cell numbers and activation-induced B cell apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aga A G 8: 53,523,191 K319R probably benign Het
Brip1 G T 11: 86,138,851 T619K possibly damaging Het
Cd300ld2 G T 11: 115,012,504 probably benign Het
Cd300lg A G 11: 102,041,594 R2G probably damaging Het
Celsr2 C T 3: 108,394,965 V2616I possibly damaging Het
Edem3 C T 1: 151,804,826 probably benign Het
Gm5431 T A 11: 48,889,168 N309I probably damaging Het
Il4 T A 11: 53,613,979 probably benign Het
Iws1 C A 18: 32,070,152 S27* probably null Het
Kdm5d T C Y: 910,441 probably benign Het
Ldb3 T C 14: 34,552,171 probably benign Het
Llgl2 A G 11: 115,847,612 T284A probably benign Het
Maml1 A T 11: 50,265,784 N521K probably damaging Het
Mlxipl T C 5: 135,132,672 Y482H probably damaging Het
Notch2 G T 3: 98,104,565 C633F probably damaging Het
Oc90 T C 15: 65,887,608 D232G probably benign Het
Olfr1453 T C 19: 13,027,825 E168G probably benign Het
Polr2a T C 11: 69,735,059 Y1717C unknown Het
Prkca T A 11: 107,939,602 I221F probably damaging Het
Rab3c T A 13: 110,084,194 K144N probably damaging Het
Ryr2 T A 13: 11,918,414 N57I probably damaging Het
Scyl3 A G 1: 163,936,499 T145A possibly damaging Het
Sept4 G A 11: 87,585,121 R162Q probably damaging Het
Slc25a39 A T 11: 102,405,024 L127H probably damaging Het
Slc9a9 T C 9: 94,685,163 V95A probably benign Het
Tsc2 T C 17: 24,625,281 I279V probably damaging Het
Usp34 C T 11: 23,489,033 P3532S possibly damaging Het
Vmn2r6 T C 3: 64,556,472 I314V probably benign Het
Wdr66 A G 5: 123,322,454 I1160V probably benign Het
Other mutations in Endou
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0364:Endou UTSW 15 97718973 splice site probably benign
R1134:Endou UTSW 15 97713866 missense probably damaging 1.00
R1418:Endou UTSW 15 97718973 splice site probably benign
R1896:Endou UTSW 15 97712992 missense probably damaging 1.00
R2960:Endou UTSW 15 97713806 missense probably damaging 1.00
R4618:Endou UTSW 15 97713882 missense possibly damaging 0.67
R4754:Endou UTSW 15 97726539 missense probably damaging 0.99
R4807:Endou UTSW 15 97731232 missense probably benign 0.01
R4997:Endou UTSW 15 97719577 missense probably damaging 1.00
R5321:Endou UTSW 15 97721032 missense probably damaging 0.99
R5470:Endou UTSW 15 97718955 missense probably damaging 1.00
R5604:Endou UTSW 15 97720919 missense probably benign 0.00
R5764:Endou UTSW 15 97714607 missense probably damaging 1.00
R6114:Endou UTSW 15 97713876 nonsense probably null
R6404:Endou UTSW 15 97712131 missense probably damaging 1.00
R6528:Endou UTSW 15 97719629 missense probably damaging 1.00
R7089:Endou UTSW 15 97720245 missense probably benign 0.01
R7103:Endou UTSW 15 97718929 missense probably damaging 1.00
R7382:Endou UTSW 15 97718926 nonsense probably null
R7707:Endou UTSW 15 97713102 critical splice acceptor site probably null
R7759:Endou UTSW 15 97713866 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACTTTGGTGATGGAGAAAGC -3'
(R):5'- ACAGACCTCAGAGTTGGCTG -3'

Sequencing Primer
(F):5'- AGCTATAGAGTTCCTTCATGACAGCC -3'
(R):5'- GCCTGGTCTACGAAGTAAATTCCAG -3'
Posted On2015-04-29