Incidental Mutation 'R4018:Olfr1453'
ID312041
Institutional Source Beutler Lab
Gene Symbol Olfr1453
Ensembl Gene ENSMUSG00000094755
Gene Nameolfactory receptor 1453
SynonymsMOR202-6, GA_x6K02T2RE5P-3357666-3356743
MMRRC Submission 040848-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R4018 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location13027404-13028327 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 13027825 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 168 (E168G)
Ref Sequence ENSEMBL: ENSMUSP00000085071 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087773]
Predicted Effect probably benign
Transcript: ENSMUST00000087773
AA Change: E168G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000085071
Gene: ENSMUSG00000094755
AA Change: E168G

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 6.6e-50 PFAM
Pfam:7tm_1 39 288 2.6e-20 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 92.4%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aga A G 8: 53,523,191 K319R probably benign Het
Brip1 G T 11: 86,138,851 T619K possibly damaging Het
Cd300ld2 G T 11: 115,012,504 probably benign Het
Cd300lg A G 11: 102,041,594 R2G probably damaging Het
Celsr2 C T 3: 108,394,965 V2616I possibly damaging Het
Edem3 C T 1: 151,804,826 probably benign Het
Endou T A 15: 97,718,937 K235M probably damaging Het
Gm5431 T A 11: 48,889,168 N309I probably damaging Het
Il4 T A 11: 53,613,979 probably benign Het
Iws1 C A 18: 32,070,152 S27* probably null Het
Kdm5d T C Y: 910,441 probably benign Het
Ldb3 T C 14: 34,552,171 probably benign Het
Llgl2 A G 11: 115,847,612 T284A probably benign Het
Maml1 A T 11: 50,265,784 N521K probably damaging Het
Mlxipl T C 5: 135,132,672 Y482H probably damaging Het
Notch2 G T 3: 98,104,565 C633F probably damaging Het
Oc90 T C 15: 65,887,608 D232G probably benign Het
Polr2a T C 11: 69,735,059 Y1717C unknown Het
Prkca T A 11: 107,939,602 I221F probably damaging Het
Rab3c T A 13: 110,084,194 K144N probably damaging Het
Ryr2 T A 13: 11,918,414 N57I probably damaging Het
Scyl3 A G 1: 163,936,499 T145A possibly damaging Het
Sept4 G A 11: 87,585,121 R162Q probably damaging Het
Slc25a39 A T 11: 102,405,024 L127H probably damaging Het
Slc9a9 T C 9: 94,685,163 V95A probably benign Het
Tsc2 T C 17: 24,625,281 I279V probably damaging Het
Usp34 C T 11: 23,489,033 P3532S possibly damaging Het
Vmn2r6 T C 3: 64,556,472 I314V probably benign Het
Wdr66 A G 5: 123,322,454 I1160V probably benign Het
Other mutations in Olfr1453
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00914:Olfr1453 APN 19 13027591 missense probably damaging 0.98
IGL01137:Olfr1453 APN 19 13028030 missense possibly damaging 0.52
IGL01894:Olfr1453 APN 19 13028285 missense probably damaging 1.00
IGL02579:Olfr1453 APN 19 13027528 missense probably damaging 0.99
PIT4418001:Olfr1453 UTSW 19 13027731 nonsense probably null
R0099:Olfr1453 UTSW 19 13027801 missense probably damaging 1.00
R0211:Olfr1453 UTSW 19 13028282 missense possibly damaging 0.95
R0211:Olfr1453 UTSW 19 13028282 missense possibly damaging 0.95
R0395:Olfr1453 UTSW 19 13028299 missense probably damaging 1.00
R0453:Olfr1453 UTSW 19 13027931 missense probably damaging 0.97
R0847:Olfr1453 UTSW 19 13027731 nonsense probably null
R1227:Olfr1453 UTSW 19 13027853 missense probably benign
R1823:Olfr1453 UTSW 19 13027817 missense probably benign 0.06
R2509:Olfr1453 UTSW 19 13027694 missense probably damaging 1.00
R2899:Olfr1453 UTSW 19 13027694 missense probably damaging 1.00
R2964:Olfr1453 UTSW 19 13028048 missense probably benign 0.38
R2965:Olfr1453 UTSW 19 13028048 missense probably benign 0.38
R3157:Olfr1453 UTSW 19 13028047 missense probably benign 0.03
R3158:Olfr1453 UTSW 19 13028047 missense probably benign 0.03
R3409:Olfr1453 UTSW 19 13028047 missense probably benign 0.03
R3410:Olfr1453 UTSW 19 13028047 missense probably benign 0.03
R3411:Olfr1453 UTSW 19 13028047 missense probably benign 0.03
R3425:Olfr1453 UTSW 19 13028047 missense probably benign 0.03
R4668:Olfr1453 UTSW 19 13028081 missense probably benign 0.00
R4805:Olfr1453 UTSW 19 13028297 missense probably benign 0.04
R5180:Olfr1453 UTSW 19 13027412 missense probably benign 0.01
R5391:Olfr1453 UTSW 19 13027786 missense probably damaging 1.00
R5557:Olfr1453 UTSW 19 13027640 missense probably benign 0.01
R5740:Olfr1453 UTSW 19 13027562 missense probably benign 0.24
R7472:Olfr1453 UTSW 19 13028075 missense probably benign
R7832:Olfr1453 UTSW 19 13027996 missense probably benign 0.02
R7970:Olfr1453 UTSW 19 13027694 missense probably damaging 1.00
R8044:Olfr1453 UTSW 19 13027465 missense probably damaging 1.00
R8229:Olfr1453 UTSW 19 13028197 missense possibly damaging 0.55
R8474:Olfr1453 UTSW 19 13027993 missense probably damaging 1.00
Z1088:Olfr1453 UTSW 19 13028027 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGCGAGGCACATGTGGAAAC -3'
(R):5'- GTGGAAAACTACCTTTTAGCCTC -3'

Sequencing Primer
(F):5'- GGAAACAGCTTTGTGATATCCTGCAG -3'
(R):5'- CAATGGCCTATGATCGTTATGTAGC -3'
Posted On2015-04-29