Incidental Mutation 'R3960:Hao1'
ID312045
Institutional Source Beutler Lab
Gene Symbol Hao1
Ensembl Gene ENSMUSG00000027261
Gene Namehydroxyacid oxidase 1, liver
SynonymsGOX, Gox1, Hao-1
Accession Numbers

Genbank: NM_010403; MGI: 96011

Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R3960 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location134497361-134554368 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to C at 134522983 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000028704 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028704]
Predicted Effect probably null
Transcript: ENSMUST00000028704
SMART Domains Protein: ENSMUSP00000028704
Gene: ENSMUSG00000027261

DomainStartEndE-ValueType
Pfam:FMN_dh 15 362 9.1e-140 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of three related genes that have 2-hydroxyacid oxidase activity yet differ in encoded protein amino acid sequence, tissue expression and substrate preference. Subcellular location of the encoded protein is the peroxisome. Specifically, this gene is expressed primarily in liver and pancreas and the encoded protein is most active on glycolate, a two-carbon substrate. The protein is also active on 2-hydroxy fatty acids. The transcript detected at high levels in pancreas may represent an alternatively spliced form or the use of a multiple near-consensus upstream polyadenylation site. [provided by RefSeq, Jul 2008]
PHENOTYPE: Electrophoretic variants are known for this locus. The a allele determines a fast migrating band in BALB/c, CBA/H, C3H/He and C57BL/6; the b allele, a slow band in NZC; the c allele, the fastest band in DBA/Li, NFS/N, STS, 101/H and 129. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Celf4 A G 18: 25,537,754 M124T probably benign Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Etl4 A G 2: 20,340,043 T53A probably benign Het
Hmgcs2 T C 3: 98,297,477 F317S possibly damaging Het
Ildr2 T A 1: 166,309,340 W564R probably damaging Het
Impg1 G T 9: 80,440,864 F29L probably benign Het
Itgam T C 7: 128,115,175 V834A probably benign Het
Itpr2 T C 6: 146,229,764 N1948D probably damaging Het
Itpr2 C T 6: 146,425,510 V120I probably damaging Het
Katnb1 T C 8: 95,087,297 V17A possibly damaging Het
Nipbl T C 15: 8,350,534 N925D probably benign Het
Oasl2 T C 5: 114,905,037 V70A probably benign Het
Panx1 GTTCTTCT GTTCT 9: 15,006,171 probably benign Het
Pcdh10 A G 3: 45,379,314 H21R probably benign Het
Prkg2 G T 5: 98,997,495 T160K possibly damaging Het
Sec23ip C G 7: 128,776,850 T796S probably benign Het
Smarcd2 A G 11: 106,266,575 S182P probably damaging Het
Tbrg4 A G 11: 6,618,077 S484P probably benign Het
Tprkb A G 6: 85,928,801 E156G probably benign Het
Zfp647 A G 15: 76,910,976 probably null Het
Other mutations in Hao1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Hao1 APN 2 134554270 missense probably damaging 0.99
IGL00886:Hao1 APN 2 134523159 missense probably benign 0.00
IGL00954:Hao1 APN 2 134498261 missense possibly damaging 0.87
IGL01472:Hao1 APN 2 134554230 missense probably benign 0.04
IGL01570:Hao1 APN 2 134554200 missense probably damaging 0.97
3-1:Hao1 UTSW 2 134500996 critical splice donor site probably null
R0928:Hao1 UTSW 2 134505616 missense possibly damaging 0.54
R0948:Hao1 UTSW 2 134530773 missense probably damaging 1.00
R1204:Hao1 UTSW 2 134523027 nonsense probably null
R1748:Hao1 UTSW 2 134498318 missense possibly damaging 0.67
R1827:Hao1 UTSW 2 134530664 missense probably benign 0.09
R1828:Hao1 UTSW 2 134530664 missense probably benign 0.09
R1917:Hao1 UTSW 2 134523060 missense probably benign 0.02
R2054:Hao1 UTSW 2 134498258 synonymous silent
R2070:Hao1 UTSW 2 134530615 missense probably damaging 1.00
R3831:Hao1 UTSW 2 134523005 missense probably damaging 1.00
R3833:Hao1 UTSW 2 134523005 missense probably damaging 1.00
R4509:Hao1 UTSW 2 134523044 missense probably damaging 0.99
R4635:Hao1 UTSW 2 134523152 missense probably damaging 1.00
R4662:Hao1 UTSW 2 134523027 nonsense probably null
R4716:Hao1 UTSW 2 134505620 missense probably damaging 1.00
R6161:Hao1 UTSW 2 134505625 missense probably benign 0.06
R6374:Hao1 UTSW 2 134523104 missense probably benign 0.14
R6799:Hao1 UTSW 2 134530765 missense probably damaging 1.00
R6876:Hao1 UTSW 2 134501149 missense probably benign 0.00
R7305:Hao1 UTSW 2 134548201 missense probably benign 0.00
R7554:Hao1 UTSW 2 134530618 missense possibly damaging 0.78
R7585:Hao1 UTSW 2 134501156 missense probably damaging 1.00
R7920:Hao1 UTSW 2 134548252 missense probably damaging 1.00
R8528:Hao1 UTSW 2 134522993 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCCACAGTCAAGAGGTTTAC -3'
(R):5'- TAGGTGGCTGAGTACGTTACAG -3'

Sequencing Primer
(F):5'- TATAGTGACTCGCAAGTGCC -3'
(R):5'- TCACCAAGTCAGATATAAACTGTCTC -3'
Posted On2015-04-29