Mutagenetix > Incidental Mutations

Incidental Mutation 'R3960:2700049A03Rik'

312064

Institutional Source

Beutler Lab

Gene Symbol

2700049A03Rik

Ensembl Gene

ENSMUSG00000034601

Gene Name

RIKEN cDNA 2700049A03 gene

Synonyms

talpid3

Accession Numbers

Genbank: NM_001163378, NM_029818

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R3960 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

71136848-71243303 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to T at 71164546 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Stop codon at position 685 (E685*)

Ref Sequence

ENSEMBL: ENSMUSP00000118956 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045907] [ENSMUST00000149564]

Predicted Effect

probably null
Transcript: ENSMUST00000045907
AA Change: E685*

SMART Domains

Protein: ENSMUSP00000044701
Gene: ENSMUSG00000034601
AA Change: E685*

Domain	Start	End	E-Value	Type
Pfam:TALPID3	116	1351	N/A	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000149564
AA Change: E685*

SMART Domains

Protein: ENSMUSP00000118956
Gene: ENSMUSG00000034601
AA Change: E685*

Domain	Start	End	E-Value	Type
Pfam:TALPID3	116	1349	N/A	PFAM

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.2%
20x: 94.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a conserved centrosomal protein that functions in ciliogenesis and responds to hedgehog signaling. Mutations in this gene causes Joubert syndrome 23. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for a null allele die during organogenesis, lack cilia, and show randomized L-R patterning, face and neural tube defects, pericardial edema and hemorrhages. Mouse embryonic fibroblasts homozygous for a different null allele lack cilia and asymmetrical centriolar localization. [provided by MGI curators]

Allele List at MGI

All alleles(12) : Targeted, other(2) Gene trapped(10)

Other mutations in this stock

Total: 21 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Celf4	A	G	18: 25,537,754	M124T	probably benign	Het
Espl1	A	G	15: 102,312,989	I944V	probably damaging	Het
Etl4	A	G	2: 20,340,043	T53A	probably benign	Het
Hao1	A	C	2: 134,522,983		probably null	Het
Hmgcs2	T	C	3: 98,297,477	F317S	possibly damaging	Het
Ildr2	T	A	1: 166,309,340	W564R	probably damaging	Het
Impg1	G	T	9: 80,440,864	F29L	probably benign	Het
Itgam	T	C	7: 128,115,175	V834A	probably benign	Het
Itpr2	T	C	6: 146,229,764	N1948D	probably damaging	Het
Itpr2	C	T	6: 146,425,510	V120I	probably damaging	Het
Katnb1	T	C	8: 95,087,297	V17A	possibly damaging	Het
Nipbl	T	C	15: 8,350,534	N925D	probably benign	Het
Oasl2	T	C	5: 114,905,037	V70A	probably benign	Het
Panx1	GTTCTTCT	GTTCT	9: 15,006,171		probably benign	Het
Pcdh10	A	G	3: 45,379,314	H21R	probably benign	Het
Prkg2	G	T	5: 98,997,495	T160K	possibly damaging	Het
Sec23ip	C	G	7: 128,776,850	T796S	probably benign	Het
Smarcd2	A	G	11: 106,266,575	S182P	probably damaging	Het
Tbrg4	A	G	11: 6,618,077	S484P	probably benign	Het
Tprkb	A	G	6: 85,928,801	E156G	probably benign	Het
Zfp647	A	G	15: 76,910,976		probably null	Het

Other mutations in 2700049A03Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00339:2700049A03Rik	APN	12	71167119	missense	probably benign	0.00
IGL01107:2700049A03Rik	APN	12	71194468	critical splice donor site	probably null
IGL01404:2700049A03Rik	APN	12	71164378	splice site	probably null
IGL01835:2700049A03Rik	APN	12	71167181	nonsense	probably null
IGL01835:2700049A03Rik	APN	12	71167183	missense	probably benign	0.00
IGL02122:2700049A03Rik	APN	12	71170525	missense	possibly damaging	0.93
IGL02140:2700049A03Rik	APN	12	71148260	missense	probably benign	0.06
IGL02385:2700049A03Rik	APN	12	71154856	missense	probably damaging	0.98
IGL03181:2700049A03Rik	APN	12	71193373	missense	possibly damaging	0.51
IGL03253:2700049A03Rik	APN	12	71140883	missense	probably benign	0.33
IGL03278:2700049A03Rik	APN	12	71158825	splice site	probably benign
G4846:2700049A03Rik	UTSW	12	71137909	missense	probably benign
PIT1430001:2700049A03Rik	UTSW	12	71160386	missense	possibly damaging	0.71
PIT4519001:2700049A03Rik	UTSW	12	71170666	missense	probably benign	0.05
R0108:2700049A03Rik	UTSW	12	71177918	missense	probably benign	0.14
R0165:2700049A03Rik	UTSW	12	71167150	missense	possibly damaging	0.52
R0211:2700049A03Rik	UTSW	12	71216096	missense	possibly damaging	0.96
R0211:2700049A03Rik	UTSW	12	71216096	missense	possibly damaging	0.96
R0220:2700049A03Rik	UTSW	12	71148420	critical splice donor site	probably null
R0352:2700049A03Rik	UTSW	12	71138030	missense	possibly damaging	0.96
R0468:2700049A03Rik	UTSW	12	71193310	missense	possibly damaging	0.71
R0508:2700049A03Rik	UTSW	12	71164388	missense	probably damaging	0.98
R0673:2700049A03Rik	UTSW	12	71177868	missense	probably damaging	0.97
R0840:2700049A03Rik	UTSW	12	71158883	missense	probably benign	0.16
R0893:2700049A03Rik	UTSW	12	71219308	splice site	probably benign
R1244:2700049A03Rik	UTSW	12	71216144	missense	probably benign	0.25
R1432:2700049A03Rik	UTSW	12	71170587	unclassified	probably null
R1599:2700049A03Rik	UTSW	12	71150259	missense	probably damaging	0.98
R1732:2700049A03Rik	UTSW	12	71219221	missense	probably benign	0.18
R1820:2700049A03Rik	UTSW	12	71150244	missense	possibly damaging	0.51
R1939:2700049A03Rik	UTSW	12	71160412	splice site	probably null
R1998:2700049A03Rik	UTSW	12	71188619	missense	possibly damaging	0.86
R2337:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R2337:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R2340:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R2340:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R2382:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R2382:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R2384:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R2384:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R2445:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R2445:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R2449:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R2449:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R2512:2700049A03Rik	UTSW	12	71173171	missense	possibly damaging	0.71
R2872:2700049A03Rik	UTSW	12	71154756	splice site	probably benign
R3236:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R3236:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R3237:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R3237:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R3734:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R3734:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R3808:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R3808:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R3809:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R3809:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R3944:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R3944:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R3959:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R3959:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R3960:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4593:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4593:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4595:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4595:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4596:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4596:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4600:2700049A03Rik	UTSW	12	71148263	missense	possibly damaging	0.67
R4649:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4649:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4651:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4651:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4652:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4652:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4714:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4714:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4735:2700049A03Rik	UTSW	12	71216123	missense	possibly damaging	0.88
R4810:2700049A03Rik	UTSW	12	71189442	missense	possibly damaging	0.51
R4852:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4852:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4854:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4854:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4855:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4855:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4884:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4884:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4893:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4893:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4905:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4905:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4915:2700049A03Rik	UTSW	12	71189646	missense	possibly damaging	0.92
R4919:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4919:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4959:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4959:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4989:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4989:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R5011:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R5011:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R5012:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R5012:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R5118:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R5118:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R5146:2700049A03Rik	UTSW	12	71243025	missense	possibly damaging	0.85
R5163:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R5163:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R5188:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R5188:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R5189:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R5189:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R5189:2700049A03Rik	UTSW	12	71193349	missense	possibly damaging	0.93
R5190:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R5190:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R5290:2700049A03Rik	UTSW	12	71188791	missense	probably benign	0.00
R5344:2700049A03Rik	UTSW	12	71243027	missense	probably benign
R5502:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R5502:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R5503:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R5503:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R5619:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R5619:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R5667:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R5667:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R5669:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R5669:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R5671:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R5671:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R5725:2700049A03Rik	UTSW	12	71193319	missense	probably benign	0.05
R5956:2700049A03Rik	UTSW	12	71157119	missense	possibly damaging	0.86
R6051:2700049A03Rik	UTSW	12	71184530	missense	possibly damaging	0.84
R6148:2700049A03Rik	UTSW	12	71187426	missense	possibly damaging	0.71
R6158:2700049A03Rik	UTSW	12	71170636	missense	possibly damaging	0.51
R6916:2700049A03Rik	UTSW	12	71164544	missense	possibly damaging	0.86
R7129:2700049A03Rik	UTSW	12	71216230	intron	probably null
R7168:2700049A03Rik	UTSW	12	71216057	missense	probably damaging	0.98
R7193:2700049A03Rik	UTSW	12	71219189	critical splice acceptor site	probably null
R7200:2700049A03Rik	UTSW	12	71140906	missense	probably damaging	0.96
R7359:2700049A03Rik	UTSW	12	71189574	missense	possibly damaging	0.51
R7488:2700049A03Rik	UTSW	12	71150405	missense	possibly damaging	0.67
R7755:2700049A03Rik	UTSW	12	71189413	missense	probably benign	0.02
R7757:2700049A03Rik	UTSW	12	71189413	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- AAGACCTTTTATGTTTCCTAGGTGG -3'
(R):5'- ACTGTTCCCTGGCAGATAAC -3'

Sequencing Primer
(F):5'- AACATGTTTTGCATTGGTAGGGCC -3'
(R):5'- TAACGGTACTGAAGCTCTGC -3'

Posted On

2015-04-29