Incidental Mutation 'R3961:Tmem131'
ID312071
Institutional Source Beutler Lab
Gene Symbol Tmem131
Ensembl Gene ENSMUSG00000026116
Gene Nametransmembrane protein 131
Synonyms2610524E03Rik, D1Bwg0491e, CC28, Neg, Rw1, YR-23
MMRRC Submission 040836-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.831) question?
Stock #R3961 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location36792191-36943666 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 36818950 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 741 (D741N)
Ref Sequence ENSEMBL: ENSMUSP00000142307 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027290] [ENSMUST00000186486] [ENSMUST00000189470] [ENSMUST00000190442] [ENSMUST00000194563]
Predicted Effect probably damaging
Transcript: ENSMUST00000027290
AA Change: D741N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027290
Gene: ENSMUSG00000026116
AA Change: D741N

DomainStartEndE-ValueType
low complexity region 5 44 N/A INTRINSIC
low complexity region 77 89 N/A INTRINSIC
Pfam:TMEM131_like 106 189 1.7e-32 PFAM
transmembrane domain 1081 1103 N/A INTRINSIC
transmembrane domain 1116 1138 N/A INTRINSIC
low complexity region 1232 1258 N/A INTRINSIC
low complexity region 1283 1315 N/A INTRINSIC
low complexity region 1369 1382 N/A INTRINSIC
low complexity region 1384 1433 N/A INTRINSIC
low complexity region 1460 1471 N/A INTRINSIC
low complexity region 1595 1610 N/A INTRINSIC
low complexity region 1613 1626 N/A INTRINSIC
low complexity region 1628 1646 N/A INTRINSIC
low complexity region 1675 1684 N/A INTRINSIC
low complexity region 1693 1701 N/A INTRINSIC
low complexity region 1738 1748 N/A INTRINSIC
low complexity region 1760 1779 N/A INTRINSIC
low complexity region 1799 1810 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186486
SMART Domains Protein: ENSMUSP00000142080
Gene: ENSMUSG00000026116

DomainStartEndE-ValueType
low complexity region 31 48 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189470
Predicted Effect probably damaging
Transcript: ENSMUST00000190442
AA Change: D37N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191381
Predicted Effect probably damaging
Transcript: ENSMUST00000194563
AA Change: D741N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142307
Gene: ENSMUSG00000026116
AA Change: D741N

DomainStartEndE-ValueType
low complexity region 5 44 N/A INTRINSIC
low complexity region 77 89 N/A INTRINSIC
Pfam:DUF3651 170 243 1.9e-27 PFAM
Pfam:DUF3651 500 580 4.5e-16 PFAM
Pfam:DUF3651 631 706 5.2e-15 PFAM
transmembrane domain 1081 1103 N/A INTRINSIC
transmembrane domain 1116 1138 N/A INTRINSIC
low complexity region 1232 1258 N/A INTRINSIC
low complexity region 1283 1315 N/A INTRINSIC
low complexity region 1369 1382 N/A INTRINSIC
low complexity region 1384 1433 N/A INTRINSIC
low complexity region 1460 1471 N/A INTRINSIC
low complexity region 1595 1610 N/A INTRINSIC
low complexity region 1613 1626 N/A INTRINSIC
low complexity region 1628 1646 N/A INTRINSIC
low complexity region 1675 1684 N/A INTRINSIC
low complexity region 1693 1701 N/A INTRINSIC
low complexity region 1738 1748 N/A INTRINSIC
low complexity region 1760 1779 N/A INTRINSIC
low complexity region 1799 1810 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 93.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 T C 11: 48,947,976 T595A possibly damaging Het
AF529169 G A 9: 89,601,910 T478I probably damaging Het
Bicral T C 17: 46,824,825 I486M probably damaging Het
Btbd1 C A 7: 81,818,335 E146* probably null Het
Cdcp1 T C 9: 123,182,381 T344A possibly damaging Het
Cenpm A T 15: 82,234,373 L180Q possibly damaging Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Dazl A G 17: 50,288,133 V91A probably damaging Het
Dsc2 C T 18: 20,051,227 V35I probably damaging Het
Fras1 T C 5: 96,677,385 probably null Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Mme T A 3: 63,345,192 M419K probably damaging Het
Ncan G A 8: 70,110,300 T436M probably benign Het
Nphp3 G T 9: 104,003,042 E88* probably null Het
Olfr993 T C 2: 85,414,872 I2M possibly damaging Het
Pdcl T C 2: 37,352,187 M184V probably benign Het
Polr3b T C 10: 84,684,302 M694T possibly damaging Het
Pramef8 T A 4: 143,419,318 N452K probably benign Het
Prkdc T G 16: 15,829,611 probably null Het
Prss35 A G 9: 86,755,749 M191V probably benign Het
Rtn3 T C 19: 7,458,145 S142G probably damaging Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Taf7 A G 18: 37,643,121 V131A probably benign Het
Tesk1 A G 4: 43,445,133 probably null Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Tpte A G 8: 22,359,415 S553G probably damaging Het
Trpv3 A T 11: 73,287,420 K438* probably null Het
Vmn2r107 G A 17: 20,375,455 G757R probably damaging Het
Other mutations in Tmem131
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Tmem131 APN 1 36811427 missense probably damaging 1.00
IGL00945:Tmem131 APN 1 36827005 splice site probably benign
IGL01107:Tmem131 APN 1 36829581 missense probably damaging 1.00
IGL01401:Tmem131 APN 1 36799387 missense probably damaging 1.00
IGL01533:Tmem131 APN 1 36818722 missense probably damaging 1.00
IGL01701:Tmem131 APN 1 36808237 missense probably benign 0.02
IGL01784:Tmem131 APN 1 36815483 missense probably damaging 1.00
IGL01890:Tmem131 APN 1 36823156 splice site probably benign
IGL01969:Tmem131 APN 1 36825460 missense possibly damaging 0.85
IGL02327:Tmem131 APN 1 36799022 missense probably damaging 1.00
IGL02707:Tmem131 APN 1 36825479 missense probably benign 0.03
IGL02743:Tmem131 APN 1 36793151 missense probably benign 0.00
IGL03111:Tmem131 APN 1 36828144 missense probably damaging 1.00
R0063:Tmem131 UTSW 1 36819128 missense probably benign 0.09
R0063:Tmem131 UTSW 1 36819128 missense probably benign 0.09
R0238:Tmem131 UTSW 1 36828050 splice site probably benign
R0239:Tmem131 UTSW 1 36828050 splice site probably benign
R0499:Tmem131 UTSW 1 36841673 missense probably damaging 1.00
R0548:Tmem131 UTSW 1 36838038 missense probably damaging 1.00
R0845:Tmem131 UTSW 1 36816222 missense probably damaging 1.00
R0975:Tmem131 UTSW 1 36854885 missense probably damaging 1.00
R1018:Tmem131 UTSW 1 36794819 missense probably damaging 0.98
R1170:Tmem131 UTSW 1 36834898 nonsense probably null
R1443:Tmem131 UTSW 1 36825478 missense probably damaging 0.98
R1448:Tmem131 UTSW 1 36827358 missense probably benign 0.16
R1472:Tmem131 UTSW 1 36816241 missense possibly damaging 0.68
R1530:Tmem131 UTSW 1 36827009 critical splice donor site probably null
R1672:Tmem131 UTSW 1 36824759 missense probably damaging 1.00
R1872:Tmem131 UTSW 1 36807927 missense probably benign 0.05
R1914:Tmem131 UTSW 1 36796266 missense probably damaging 1.00
R1915:Tmem131 UTSW 1 36796266 missense probably damaging 1.00
R1929:Tmem131 UTSW 1 36812271 missense possibly damaging 0.50
R1971:Tmem131 UTSW 1 36804599 nonsense probably null
R2146:Tmem131 UTSW 1 36812609 missense probably benign 0.13
R2148:Tmem131 UTSW 1 36812609 missense probably benign 0.13
R2149:Tmem131 UTSW 1 36812609 missense probably benign 0.13
R2150:Tmem131 UTSW 1 36812609 missense probably benign 0.13
R2386:Tmem131 UTSW 1 36829635 missense probably benign 0.00
R2879:Tmem131 UTSW 1 36841707 missense possibly damaging 0.76
R2903:Tmem131 UTSW 1 36825297 missense probably damaging 1.00
R3430:Tmem131 UTSW 1 36808821 splice site probably benign
R3821:Tmem131 UTSW 1 36808396 missense probably damaging 0.99
R4153:Tmem131 UTSW 1 36808793 intron probably benign
R4154:Tmem131 UTSW 1 36808793 intron probably benign
R4502:Tmem131 UTSW 1 36825479 missense probably benign 0.03
R4503:Tmem131 UTSW 1 36825479 missense probably benign 0.03
R4795:Tmem131 UTSW 1 36841676 missense probably damaging 1.00
R5030:Tmem131 UTSW 1 36827174 missense possibly damaging 0.78
R5068:Tmem131 UTSW 1 36854905 missense probably damaging 1.00
R5070:Tmem131 UTSW 1 36854905 missense probably damaging 1.00
R5386:Tmem131 UTSW 1 36872558 missense possibly damaging 0.47
R5507:Tmem131 UTSW 1 36889280 missense probably damaging 1.00
R5569:Tmem131 UTSW 1 36799338 missense probably benign 0.02
R5913:Tmem131 UTSW 1 36819128 missense probably benign 0.01
R6044:Tmem131 UTSW 1 36881341 nonsense probably null
R6125:Tmem131 UTSW 1 36808306 missense possibly damaging 0.95
R6259:Tmem131 UTSW 1 36819128 missense probably benign 0.09
R6392:Tmem131 UTSW 1 36881342 missense probably benign 0.10
R6704:Tmem131 UTSW 1 36796180 missense possibly damaging 0.77
R6828:Tmem131 UTSW 1 36804643 missense possibly damaging 0.46
R6964:Tmem131 UTSW 1 36796292 missense probably damaging 0.99
R7034:Tmem131 UTSW 1 36792973 missense possibly damaging 0.80
R7036:Tmem131 UTSW 1 36792973 missense possibly damaging 0.80
R7081:Tmem131 UTSW 1 36889295 missense possibly damaging 0.94
R7278:Tmem131 UTSW 1 36796301 missense probably damaging 0.99
R7282:Tmem131 UTSW 1 36841604 missense probably damaging 1.00
R7294:Tmem131 UTSW 1 36854847 missense possibly damaging 0.88
R7635:Tmem131 UTSW 1 36872548 missense probably damaging 1.00
R7916:Tmem131 UTSW 1 36823086 missense probably benign 0.00
R7948:Tmem131 UTSW 1 36794148 missense probably damaging 1.00
R8012:Tmem131 UTSW 1 36807964 missense probably damaging 1.00
R8244:Tmem131 UTSW 1 36808893 missense probably benign 0.08
R8461:Tmem131 UTSW 1 36794821 missense probably damaging 1.00
Z1176:Tmem131 UTSW 1 36796257 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGGCTGTACTTTGGGTTC -3'
(R):5'- CAGCAAATAAGGTCTTTGTCAGAAG -3'

Sequencing Primer
(F):5'- CTGTACTTTGGGTTCAGCTAAAAGAG -3'
(R):5'- GTCAGAAGACGTACGATTCTACTAC -3'
Posted On2015-04-29