Incidental Mutation 'R3961:Pdcl'
ID312074
Institutional Source Beutler Lab
Gene Symbol Pdcl
Ensembl Gene ENSMUSG00000009030
Gene Namephosducin-like
Synonyms1200011E13Rik, PhLP1
MMRRC Submission 040836-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.939) question?
Stock #R3961 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location37350074-37359332 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37352187 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 184 (M184V)
Ref Sequence ENSEMBL: ENSMUSP00000119372 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009174] [ENSMUST00000112940] [ENSMUST00000138314] [ENSMUST00000147703]
Predicted Effect probably benign
Transcript: ENSMUST00000009174
AA Change: M184V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000009174
Gene: ENSMUSG00000009030
AA Change: M184V

DomainStartEndE-ValueType
low complexity region 15 31 N/A INTRINSIC
Pfam:Phosducin 35 299 8.6e-162 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112940
AA Change: M184V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000108562
Gene: ENSMUSG00000009030
AA Change: M184V

DomainStartEndE-ValueType
low complexity region 15 31 N/A INTRINSIC
Pfam:Phosducin 35 299 8.6e-162 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138314
SMART Domains Protein: ENSMUSP00000145483
Gene: ENSMUSG00000009030

DomainStartEndE-ValueType
low complexity region 15 31 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147703
AA Change: M184V

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000119372
Gene: ENSMUSG00000009030
AA Change: M184V

DomainStartEndE-ValueType
low complexity region 15 31 N/A INTRINSIC
Pfam:Phosducin 35 193 6.8e-90 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosducin-like protein is a putative modulator of heterotrimeric G proteins. The protein shares extensive amino acid sequence homology with phosducin, a phosphoprotein expressed in retina and pineal gland. Both phosducin-like protein and phosphoducin have been shown to regulate G-protein signaling by binding to the beta-gamma subunits of G proteins. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 T C 11: 48,947,976 T595A possibly damaging Het
AF529169 G A 9: 89,601,910 T478I probably damaging Het
Bicral T C 17: 46,824,825 I486M probably damaging Het
Btbd1 C A 7: 81,818,335 E146* probably null Het
Cdcp1 T C 9: 123,182,381 T344A possibly damaging Het
Cenpm A T 15: 82,234,373 L180Q possibly damaging Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Dazl A G 17: 50,288,133 V91A probably damaging Het
Dsc2 C T 18: 20,051,227 V35I probably damaging Het
Fras1 T C 5: 96,677,385 probably null Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Mme T A 3: 63,345,192 M419K probably damaging Het
Ncan G A 8: 70,110,300 T436M probably benign Het
Nphp3 G T 9: 104,003,042 E88* probably null Het
Olfr993 T C 2: 85,414,872 I2M possibly damaging Het
Polr3b T C 10: 84,684,302 M694T possibly damaging Het
Pramef8 T A 4: 143,419,318 N452K probably benign Het
Prkdc T G 16: 15,829,611 probably null Het
Prss35 A G 9: 86,755,749 M191V probably benign Het
Rtn3 T C 19: 7,458,145 S142G probably damaging Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Taf7 A G 18: 37,643,121 V131A probably benign Het
Tesk1 A G 4: 43,445,133 probably null Het
Tmem131 C T 1: 36,818,950 D741N probably damaging Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Tpte A G 8: 22,359,415 S553G probably damaging Het
Trpv3 A T 11: 73,287,420 K438* probably null Het
Vmn2r107 G A 17: 20,375,455 G757R probably damaging Het
Other mutations in Pdcl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00928:Pdcl APN 2 37357374 start codon destroyed probably null 1.00
R0019:Pdcl UTSW 2 37351920 missense probably damaging 0.99
R0019:Pdcl UTSW 2 37351920 missense probably damaging 0.99
R0147:Pdcl UTSW 2 37352130 missense probably benign 0.00
R0148:Pdcl UTSW 2 37352130 missense probably benign 0.00
R0157:Pdcl UTSW 2 37352177 missense probably damaging 1.00
R1876:Pdcl UTSW 2 37355696 missense probably damaging 0.99
R2202:Pdcl UTSW 2 37352044 missense probably benign 0.28
R2203:Pdcl UTSW 2 37352044 missense probably benign 0.28
R2204:Pdcl UTSW 2 37352044 missense probably benign 0.28
R2896:Pdcl UTSW 2 37355690 missense possibly damaging 0.93
R4010:Pdcl UTSW 2 37352111 missense probably damaging 1.00
R4663:Pdcl UTSW 2 37355766 missense probably damaging 1.00
R6896:Pdcl UTSW 2 37352179 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTTGTAGATGAGCAGAGC -3'
(R):5'- GATCAAATGTGTTCTTTGCCTGTC -3'

Sequencing Primer
(F):5'- CCTTGTAGATGAGCAGAGCAGGAAG -3'
(R):5'- TTCATGCAGATGACTCTAAAGGAG -3'
Posted On2015-04-29