Incidental Mutation 'R3961:Pramef8'
ID312079
Institutional Source Beutler Lab
Gene Symbol Pramef8
Ensembl Gene ENSMUSG00000046862
Gene NamePRAME family member 8
Synonyms4732496O08Rik
MMRRC Submission 040836-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R3961 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location143412426-143421091 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 143419318 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 452 (N452K)
Ref Sequence ENSEMBL: ENSMUSP00000058676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037356] [ENSMUST00000059790] [ENSMUST00000132915] [ENSMUST00000155157]
Predicted Effect probably benign
Transcript: ENSMUST00000037356
AA Change: N452K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000041323
Gene: ENSMUSG00000046862
AA Change: N452K

DomainStartEndE-ValueType
SCOP:d1a4ya_ 205 410 3e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000059790
AA Change: N452K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000058676
Gene: ENSMUSG00000046862
AA Change: N452K

DomainStartEndE-ValueType
SCOP:d1a4ya_ 205 410 3e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126398
Predicted Effect probably benign
Transcript: ENSMUST00000132915
Predicted Effect probably benign
Transcript: ENSMUST00000155157
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 93.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 T C 11: 48,947,976 T595A possibly damaging Het
AF529169 G A 9: 89,601,910 T478I probably damaging Het
Bicral T C 17: 46,824,825 I486M probably damaging Het
Btbd1 C A 7: 81,818,335 E146* probably null Het
Cdcp1 T C 9: 123,182,381 T344A possibly damaging Het
Cenpm A T 15: 82,234,373 L180Q possibly damaging Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Dazl A G 17: 50,288,133 V91A probably damaging Het
Dsc2 C T 18: 20,051,227 V35I probably damaging Het
Fras1 T C 5: 96,677,385 probably null Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Mme T A 3: 63,345,192 M419K probably damaging Het
Ncan G A 8: 70,110,300 T436M probably benign Het
Nphp3 G T 9: 104,003,042 E88* probably null Het
Olfr993 T C 2: 85,414,872 I2M possibly damaging Het
Pdcl T C 2: 37,352,187 M184V probably benign Het
Polr3b T C 10: 84,684,302 M694T possibly damaging Het
Prkdc T G 16: 15,829,611 probably null Het
Prss35 A G 9: 86,755,749 M191V probably benign Het
Rtn3 T C 19: 7,458,145 S142G probably damaging Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Taf7 A G 18: 37,643,121 V131A probably benign Het
Tesk1 A G 4: 43,445,133 probably null Het
Tmem131 C T 1: 36,818,950 D741N probably damaging Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Tpte A G 8: 22,359,415 S553G probably damaging Het
Trpv3 A T 11: 73,287,420 K438* probably null Het
Vmn2r107 G A 17: 20,375,455 G757R probably damaging Het
Other mutations in Pramef8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Pramef8 APN 4 143416667 start codon destroyed probably null 1.00
IGL01483:Pramef8 APN 4 143417477 missense probably damaging 0.99
IGL01800:Pramef8 APN 4 143419080 missense probably damaging 1.00
IGL02063:Pramef8 APN 4 143417851 missense probably benign 0.00
IGL02216:Pramef8 APN 4 143417728 splice site probably null
IGL02236:Pramef8 APN 4 143416942 missense probably benign 0.07
IGL03013:Pramef8 APN 4 143417467 missense possibly damaging 0.64
R0658:Pramef8 UTSW 4 143417600 missense probably damaging 1.00
R1485:Pramef8 UTSW 4 143417618 missense probably benign 0.01
R2049:Pramef8 UTSW 4 143416871 missense probably damaging 1.00
R2518:Pramef8 UTSW 4 143417903 missense possibly damaging 0.89
R3720:Pramef8 UTSW 4 143419379 missense probably benign 0.10
R3738:Pramef8 UTSW 4 143416642 utr 5 prime probably benign
R4583:Pramef8 UTSW 4 143416754 missense probably damaging 1.00
R5135:Pramef8 UTSW 4 143419009 missense probably benign 0.01
R5348:Pramef8 UTSW 4 143416781 missense probably damaging 1.00
R5473:Pramef8 UTSW 4 143419304 missense probably damaging 1.00
R5977:Pramef8 UTSW 4 143417659 missense probably benign 0.02
R6909:Pramef8 UTSW 4 143417909 missense probably damaging 1.00
R7441:Pramef8 UTSW 4 143418840 missense probably benign 0.00
R7777:Pramef8 UTSW 4 143417761 missense possibly damaging 0.88
R8053:Pramef8 UTSW 4 143417638 missense probably benign 0.01
R8218:Pramef8 UTSW 4 143419136 missense probably benign 0.01
R8345:Pramef8 UTSW 4 143416868 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- TGGCTGTTCTAAAGGACCTTC -3'
(R):5'- TTGTGGTCTAACCCTCCAGC -3'

Sequencing Primer
(F):5'- GTTCTAAAGGACCTTCTGTATCACAC -3'
(R):5'- CCATTTGGGTTCCCAGATAATGAGC -3'
Posted On2015-04-29