Incidental Mutation 'R3961:Cers3'
ID312083
Institutional Source Beutler Lab
Gene Symbol Cers3
Ensembl Gene ENSMUSG00000030510
Gene Nameceramide synthase 3
Synonymsrelated to TRH3, Lass3, T3L, CerS3, 4930550L11Rik, LOC233330
MMRRC Submission 040836-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.310) question?
Stock #R3961 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location66743504-66823691 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 66786075 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 261 (A261S)
Ref Sequence ENSEMBL: ENSMUSP00000069238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066475] [ENSMUST00000208521]
Predicted Effect probably benign
Transcript: ENSMUST00000066475
AA Change: A261S

PolyPhen 2 Score 0.253 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000069238
Gene: ENSMUSG00000030510
AA Change: A261S

DomainStartEndE-ValueType
transmembrane domain 66 88 N/A INTRINSIC
HOX 110 167 2.48e-2 SMART
TLC 166 367 6.52e-57 SMART
low complexity region 379 391 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000208521
AA Change: A225S

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
Meta Mutation Damage Score 0.1052 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the ceramide synthase family of genes. The ceramide synthase enzymes regulate sphingolipid synthesis by catalyzing the formation of ceramides from sphingoid base and acyl-coA substrates. This family member is involved in the synthesis of ceramides with ultra-long-chain acyl moieties (ULC-Cers), important to the epidermis in its role in creating a protective barrier from the environment. The protein encoded by this gene has also been implicated in modification of the lipid structures required for spermatogenesis. Mutations in this gene have been associated with male fertility defects, and epidermal defects, including ichthyosis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a lethal skin barrier disruption defect due to a lack of ultra-long-chain acyl ceramides, impaired stratum corneum desquamation, accelerated lamellar body biogenesis and extrusion, and delayed keratinocyte cornification. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 T C 11: 48,947,976 T595A possibly damaging Het
AF529169 G A 9: 89,601,910 T478I probably damaging Het
Bicral T C 17: 46,824,825 I486M probably damaging Het
Btbd1 C A 7: 81,818,335 E146* probably null Het
Cdcp1 T C 9: 123,182,381 T344A possibly damaging Het
Cenpm A T 15: 82,234,373 L180Q possibly damaging Het
Dazl A G 17: 50,288,133 V91A probably damaging Het
Dsc2 C T 18: 20,051,227 V35I probably damaging Het
Fras1 T C 5: 96,677,385 probably null Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Mme T A 3: 63,345,192 M419K probably damaging Het
Ncan G A 8: 70,110,300 T436M probably benign Het
Nphp3 G T 9: 104,003,042 E88* probably null Het
Olfr993 T C 2: 85,414,872 I2M possibly damaging Het
Pdcl T C 2: 37,352,187 M184V probably benign Het
Polr3b T C 10: 84,684,302 M694T possibly damaging Het
Pramef8 T A 4: 143,419,318 N452K probably benign Het
Prkdc T G 16: 15,829,611 probably null Het
Prss35 A G 9: 86,755,749 M191V probably benign Het
Rtn3 T C 19: 7,458,145 S142G probably damaging Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Taf7 A G 18: 37,643,121 V131A probably benign Het
Tesk1 A G 4: 43,445,133 probably null Het
Tmem131 C T 1: 36,818,950 D741N probably damaging Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Tpte A G 8: 22,359,415 S553G probably damaging Het
Trpv3 A T 11: 73,287,420 K438* probably null Het
Vmn2r107 G A 17: 20,375,455 G757R probably damaging Het
Other mutations in Cers3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01321:Cers3 APN 7 66786003 splice site probably benign
IGL02832:Cers3 APN 7 66781825 missense probably benign 0.00
R0400:Cers3 UTSW 7 66764330 missense probably benign 0.03
R0490:Cers3 UTSW 7 66773690 missense possibly damaging 0.69
R0558:Cers3 UTSW 7 66783418 missense probably damaging 1.00
R0571:Cers3 UTSW 7 66786057 missense possibly damaging 0.93
R1452:Cers3 UTSW 7 66783404 missense probably damaging 1.00
R1538:Cers3 UTSW 7 66781823 missense probably damaging 0.98
R1767:Cers3 UTSW 7 66783403 missense probably damaging 1.00
R2155:Cers3 UTSW 7 66783414 missense probably damaging 0.99
R2427:Cers3 UTSW 7 66795793 missense probably benign 0.04
R3705:Cers3 UTSW 7 66786075 missense probably benign 0.25
R3713:Cers3 UTSW 7 66786075 missense probably benign 0.25
R3714:Cers3 UTSW 7 66786075 missense probably benign 0.25
R3715:Cers3 UTSW 7 66786075 missense probably benign 0.25
R3963:Cers3 UTSW 7 66786075 missense probably benign 0.25
R4238:Cers3 UTSW 7 66773676 missense probably damaging 1.00
R4652:Cers3 UTSW 7 66781856 splice site probably null
R5174:Cers3 UTSW 7 66784868 missense probably damaging 1.00
R6493:Cers3 UTSW 7 66743720 missense probably benign 0.07
R6675:Cers3 UTSW 7 66786096 missense possibly damaging 0.50
R6807:Cers3 UTSW 7 66764220 missense probably damaging 1.00
R6833:Cers3 UTSW 7 66779671 critical splice donor site probably null
R7223:Cers3 UTSW 7 66783415 missense probably damaging 0.99
R7592:Cers3 UTSW 7 66789629 missense probably damaging 1.00
R7835:Cers3 UTSW 7 66773639 missense possibly damaging 0.79
R8202:Cers3 UTSW 7 66786013 missense probably damaging 0.99
R8322:Cers3 UTSW 7 66789638 missense probably damaging 1.00
R8350:Cers3 UTSW 7 66764342 missense possibly damaging 0.54
R8450:Cers3 UTSW 7 66764342 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- TCCCTCACAAGGACCCTGTTAAG -3'
(R):5'- TGTTTTCAGGACAGAGTGCCC -3'

Sequencing Primer
(F):5'- TCACAAGGACCCTGTTAAGAAAAAC -3'
(R):5'- GGACAGAGTGCCCTTCCAAATC -3'
Posted On2015-04-29