Incidental Mutation 'R3961:Btbd1'
ID312084
Institutional Source Beutler Lab
Gene Symbol Btbd1
Ensembl Gene ENSMUSG00000025103
Gene NameBTB (POZ) domain containing 1
Synonyms
MMRRC Submission 040836-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.299) question?
Stock #R3961 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location81792074-81829431 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 81818335 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 146 (E146*)
Ref Sequence ENSEMBL: ENSMUSP00000026093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026093]
Predicted Effect probably null
Transcript: ENSMUST00000026093
AA Change: E146*
SMART Domains Protein: ENSMUSP00000026093
Gene: ENSMUSG00000025103
AA Change: E146*

DomainStartEndE-ValueType
low complexity region 5 45 N/A INTRINSIC
BTB 75 181 2.73e-22 SMART
BACK 186 294 8.02e-10 SMART
Pfam:PHR 339 487 2.2e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208178
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208566
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The C-terminus of the protein encoded by this gene binds topoisomerase I. The N-terminus contains a proline-rich region and a BTB/POZ domain (broad-complex, Tramtrack and bric a brac/Pox virus and Zinc finger), both of which are typically involved in protein-protein interactions. Subcellularly, the protein localizes to cytoplasmic bodies. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 T C 11: 48,947,976 T595A possibly damaging Het
AF529169 G A 9: 89,601,910 T478I probably damaging Het
Bicral T C 17: 46,824,825 I486M probably damaging Het
Cdcp1 T C 9: 123,182,381 T344A possibly damaging Het
Cenpm A T 15: 82,234,373 L180Q possibly damaging Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Dazl A G 17: 50,288,133 V91A probably damaging Het
Dsc2 C T 18: 20,051,227 V35I probably damaging Het
Fras1 T C 5: 96,677,385 probably null Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Mme T A 3: 63,345,192 M419K probably damaging Het
Ncan G A 8: 70,110,300 T436M probably benign Het
Nphp3 G T 9: 104,003,042 E88* probably null Het
Olfr993 T C 2: 85,414,872 I2M possibly damaging Het
Pdcl T C 2: 37,352,187 M184V probably benign Het
Polr3b T C 10: 84,684,302 M694T possibly damaging Het
Pramef8 T A 4: 143,419,318 N452K probably benign Het
Prkdc T G 16: 15,829,611 probably null Het
Prss35 A G 9: 86,755,749 M191V probably benign Het
Rtn3 T C 19: 7,458,145 S142G probably damaging Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Taf7 A G 18: 37,643,121 V131A probably benign Het
Tesk1 A G 4: 43,445,133 probably null Het
Tmem131 C T 1: 36,818,950 D741N probably damaging Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Tpte A G 8: 22,359,415 S553G probably damaging Het
Trpv3 A T 11: 73,287,420 K438* probably null Het
Vmn2r107 G A 17: 20,375,455 G757R probably damaging Het
Other mutations in Btbd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01298:Btbd1 APN 7 81794307 splice site probably null
IGL01476:Btbd1 APN 7 81801049 nonsense probably null
IGL02261:Btbd1 APN 7 81805759 missense probably damaging 0.98
R0164:Btbd1 UTSW 7 81801003 missense probably benign 0.28
R0164:Btbd1 UTSW 7 81801003 missense probably benign 0.28
R0600:Btbd1 UTSW 7 81816006 missense probably damaging 1.00
R1221:Btbd1 UTSW 7 81818257 missense possibly damaging 0.79
R2159:Btbd1 UTSW 7 81801056 missense possibly damaging 0.94
R4769:Btbd1 UTSW 7 81805810 missense probably benign 0.04
R7159:Btbd1 UTSW 7 81818209 missense probably benign 0.44
R7331:Btbd1 UTSW 7 81815972 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGATTCCAGTCAATAACCAGAATTC -3'
(R):5'- GGAATCAGAGTCTGTGCAGG -3'

Sequencing Primer
(F):5'- CCTTCCAAGTGCTGGGTCTAAAAG -3'
(R):5'- GTGCTGCTTACCCGATGCAAAG -3'
Posted On2015-04-29