Incidental Mutation 'R3961:Prss35'
ID312087
Institutional Source Beutler Lab
Gene Symbol Prss35
Ensembl Gene ENSMUSG00000033491
Gene Nameprotease, serine 35
Synonyms6030424L22Rik
MMRRC Submission 040836-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R3961 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location86743649-86758443 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86755749 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 191 (M191V)
Ref Sequence ENSEMBL: ENSMUSP00000035271 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036426] [ENSMUST00000179574]
Predicted Effect probably benign
Transcript: ENSMUST00000036426
AA Change: M191V

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000035271
Gene: ENSMUSG00000033491
AA Change: M191V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 68 83 N/A INTRINSIC
Tryp_SPc 132 399 4.13e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179574
AA Change: M191V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000137445
Gene: ENSMUSG00000033491
AA Change: M191V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 68 83 N/A INTRINSIC
Tryp_SPc 132 399 4.13e-2 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 93.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 T C 11: 48,947,976 T595A possibly damaging Het
AF529169 G A 9: 89,601,910 T478I probably damaging Het
Bicral T C 17: 46,824,825 I486M probably damaging Het
Btbd1 C A 7: 81,818,335 E146* probably null Het
Cdcp1 T C 9: 123,182,381 T344A possibly damaging Het
Cenpm A T 15: 82,234,373 L180Q possibly damaging Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Dazl A G 17: 50,288,133 V91A probably damaging Het
Dsc2 C T 18: 20,051,227 V35I probably damaging Het
Fras1 T C 5: 96,677,385 probably null Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Mme T A 3: 63,345,192 M419K probably damaging Het
Ncan G A 8: 70,110,300 T436M probably benign Het
Nphp3 G T 9: 104,003,042 E88* probably null Het
Olfr993 T C 2: 85,414,872 I2M possibly damaging Het
Pdcl T C 2: 37,352,187 M184V probably benign Het
Polr3b T C 10: 84,684,302 M694T possibly damaging Het
Pramef8 T A 4: 143,419,318 N452K probably benign Het
Prkdc T G 16: 15,829,611 probably null Het
Rtn3 T C 19: 7,458,145 S142G probably damaging Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Taf7 A G 18: 37,643,121 V131A probably benign Het
Tesk1 A G 4: 43,445,133 probably null Het
Tmem131 C T 1: 36,818,950 D741N probably damaging Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Tpte A G 8: 22,359,415 S553G probably damaging Het
Trpv3 A T 11: 73,287,420 K438* probably null Het
Vmn2r107 G A 17: 20,375,455 G757R probably damaging Het
Other mutations in Prss35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Prss35 APN 9 86755274 missense probably benign 0.00
IGL02749:Prss35 APN 9 86756244 missense probably damaging 1.00
R0346:Prss35 UTSW 9 86755351 missense probably benign 0.04
R0403:Prss35 UTSW 9 86756037 missense probably damaging 1.00
R1664:Prss35 UTSW 9 86755647 missense probably benign 0.29
R2016:Prss35 UTSW 9 86755512 missense probably benign 0.37
R2017:Prss35 UTSW 9 86755512 missense probably benign 0.37
R2325:Prss35 UTSW 9 86756304 missense probably damaging 1.00
R2429:Prss35 UTSW 9 86755345 missense probably benign
R2965:Prss35 UTSW 9 86755582 missense probably damaging 1.00
R2966:Prss35 UTSW 9 86755582 missense probably damaging 1.00
R4792:Prss35 UTSW 9 86755669 missense probably damaging 1.00
R4902:Prss35 UTSW 9 86756122 missense probably damaging 1.00
R6169:Prss35 UTSW 9 86755438 missense probably benign 0.00
R6446:Prss35 UTSW 9 86755653 missense probably damaging 0.99
R6753:Prss35 UTSW 9 86756100 missense probably damaging 1.00
R7008:Prss35 UTSW 9 86756308 missense probably benign 0.01
R7387:Prss35 UTSW 9 86755921 missense probably damaging 1.00
R7523:Prss35 UTSW 9 86755374 missense probably damaging 1.00
R7587:Prss35 UTSW 9 86755374 missense probably damaging 1.00
R7652:Prss35 UTSW 9 86755970 missense probably benign
R8013:Prss35 UTSW 9 86755425 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCTTAGACAAAAGGTTCGCG -3'
(R):5'- TAGTCGTAGTCCAAGGCCAG -3'

Sequencing Primer
(F):5'- GCGACCAATTTCCCTTTTAATACAG -3'
(R):5'- CTCTTGACGCGGGTCCATTG -3'
Posted On2015-04-29