Incidental Mutation 'R3961:AF529169'
ID312088
Institutional Source Beutler Lab
Gene Symbol AF529169
Ensembl Gene ENSMUSG00000039313
Gene NamecDNA sequence AF529169
SynonymsDD1
MMRRC Submission 040836-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3961 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location89587216-89623125 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 89601910 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 478 (T478I)
Ref Sequence ENSEMBL: ENSMUSP00000046111 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044491] [ENSMUST00000191465]
Predicted Effect probably damaging
Transcript: ENSMUST00000044491
AA Change: T478I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046111
Gene: ENSMUSG00000039313
AA Change: T478I

DomainStartEndE-ValueType
low complexity region 508 522 N/A INTRINSIC
Pfam:UPF0258 760 915 8.7e-73 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000191465
AA Change: T478I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140942
Gene: ENSMUSG00000039313
AA Change: T478I

DomainStartEndE-ValueType
low complexity region 508 522 N/A INTRINSIC
Pfam:UPF0258 759 854 6.1e-38 PFAM
Meta Mutation Damage Score 0.1416 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 93.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 T C 11: 48,947,976 T595A possibly damaging Het
Bicral T C 17: 46,824,825 I486M probably damaging Het
Btbd1 C A 7: 81,818,335 E146* probably null Het
Cdcp1 T C 9: 123,182,381 T344A possibly damaging Het
Cenpm A T 15: 82,234,373 L180Q possibly damaging Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Dazl A G 17: 50,288,133 V91A probably damaging Het
Dsc2 C T 18: 20,051,227 V35I probably damaging Het
Fras1 T C 5: 96,677,385 probably null Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Mme T A 3: 63,345,192 M419K probably damaging Het
Ncan G A 8: 70,110,300 T436M probably benign Het
Nphp3 G T 9: 104,003,042 E88* probably null Het
Olfr993 T C 2: 85,414,872 I2M possibly damaging Het
Pdcl T C 2: 37,352,187 M184V probably benign Het
Polr3b T C 10: 84,684,302 M694T possibly damaging Het
Pramef8 T A 4: 143,419,318 N452K probably benign Het
Prkdc T G 16: 15,829,611 probably null Het
Prss35 A G 9: 86,755,749 M191V probably benign Het
Rtn3 T C 19: 7,458,145 S142G probably damaging Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Taf7 A G 18: 37,643,121 V131A probably benign Het
Tesk1 A G 4: 43,445,133 probably null Het
Tmem131 C T 1: 36,818,950 D741N probably damaging Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Tpte A G 8: 22,359,415 S553G probably damaging Het
Trpv3 A T 11: 73,287,420 K438* probably null Het
Vmn2r107 G A 17: 20,375,455 G757R probably damaging Het
Other mutations in AF529169
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:AF529169 APN 9 89601800 missense probably benign 0.02
IGL00163:AF529169 APN 9 89591097 unclassified probably benign
IGL00336:AF529169 APN 9 89603143 missense probably damaging 1.00
IGL01608:AF529169 APN 9 89596498 missense probably benign 0.15
IGL01818:AF529169 APN 9 89601313 missense probably damaging 0.99
IGL02012:AF529169 APN 9 89601438 missense probably benign 0.01
IGL02259:AF529169 APN 9 89602359 missense possibly damaging 0.93
IGL02894:AF529169 APN 9 89603102 missense probably damaging 0.99
IGL03008:AF529169 APN 9 89596678 missense probably damaging 1.00
IGL02988:AF529169 UTSW 9 89602739 missense probably benign 0.02
R0410:AF529169 UTSW 9 89602203 missense probably damaging 0.97
R0825:AF529169 UTSW 9 89603279 nonsense probably null
R0883:AF529169 UTSW 9 89602417 missense probably benign 0.05
R0989:AF529169 UTSW 9 89602035 missense probably damaging 0.99
R1376:AF529169 UTSW 9 89591246 missense probably damaging 1.00
R1376:AF529169 UTSW 9 89591246 missense probably damaging 1.00
R1632:AF529169 UTSW 9 89602360 missense probably damaging 0.96
R1804:AF529169 UTSW 9 89603099 missense possibly damaging 0.91
R1974:AF529169 UTSW 9 89601203 missense probably damaging 1.00
R2151:AF529169 UTSW 9 89602168 missense possibly damaging 0.53
R2882:AF529169 UTSW 9 89602802 missense possibly damaging 0.86
R2909:AF529169 UTSW 9 89591278 missense probably damaging 1.00
R3962:AF529169 UTSW 9 89601910 missense probably damaging 1.00
R3963:AF529169 UTSW 9 89601910 missense probably damaging 1.00
R4676:AF529169 UTSW 9 89601553 missense probably damaging 1.00
R4778:AF529169 UTSW 9 89603102 missense probably damaging 1.00
R4931:AF529169 UTSW 9 89601652 missense probably benign 0.05
R5300:AF529169 UTSW 9 89603199 missense probably damaging 1.00
R5702:AF529169 UTSW 9 89591155 missense probably benign 0.22
R5759:AF529169 UTSW 9 89601072 missense probably benign 0.01
R6187:AF529169 UTSW 9 89591167 missense probably damaging 1.00
R7320:AF529169 UTSW 9 89601626 missense probably benign
R7542:AF529169 UTSW 9 89601911 missense probably damaging 1.00
R7552:AF529169 UTSW 9 89601835 missense probably benign 0.00
U24488:AF529169 UTSW 9 89603047 missense probably damaging 1.00
Z1177:AF529169 UTSW 9 89603162 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGATGACTGTATCACTCCTGTGG -3'
(R):5'- CCAGACAGGCATCCAGTTTAC -3'

Sequencing Primer
(F):5'- TCCTGTGGAGCCGCTGATG -3'
(R):5'- CCAGTTTACTTGGTGCCAAAGGATC -3'
Posted On2015-04-29