Mutagenetix > Incidental Mutations

Incidental Mutation 'R3961:Polr3b'

312091

Institutional Source

Beutler Lab

Gene Symbol

Polr3b

Ensembl Gene

ENSMUSG00000034453

Gene Name

polymerase (RNA) III (DNA directed) polypeptide B

Synonyms

RPC2, A330032P03Rik, 2700078H01Rik

MMRRC Submission

040836-MU

Accession Numbers

Genbank: NM_027423

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R3961 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

84622292-84727178 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 84684302 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Threonine at position 694 (M694T)

Ref Sequence

ENSEMBL: ENSMUSP00000076418 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077175]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000077175
AA Change: M694T

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000076418
Gene: ENSMUSG00000034453
AA Change: M694T

Domain	Start	End	E-Value	Type
Pfam:RNA_pol_Rpb2_1	38	413	2e-55	PFAM
Pfam:RNA_pol_Rpb2_2	185	363	8.4e-29	PFAM
Pfam:RNA_pol_Rpb2_3	438	502	2.6e-22	PFAM
Pfam:RNA_pol_Rpb2_4	539	600	1e-29	PFAM
Pfam:RNA_pol_Rpb2_5	621	661	6.5e-14	PFAM
Pfam:RNA_pol_Rpb2_6	668	1041	5.8e-129	PFAM
Pfam:RNA_pol_Rpb2_7	1043	1129	7.6e-36	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 93.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the second largest subunit of RNA polymerase III, the polymerase responsible for synthesizing transfer and small ribosomal RNAs in eukaryotes. The largest subunit and the encoded protein form the catalytic center of RNA polymerase III. Mutations in this gene are a cause of hypomyelinating leukodystrophy. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]

Allele List at MGI

All alleles(48) : Targeted, other(2) Gene trapped(46)

Other mutations in this stock

Total: 28 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930111J21Rik1	T	C	11: 48,947,976	T595A	possibly damaging	Het
AF529169	G	A	9: 89,601,910	T478I	probably damaging	Het
Bicral	T	C	17: 46,824,825	I486M	probably damaging	Het
Btbd1	C	A	7: 81,818,335	E146*	probably null	Het
Cdcp1	T	C	9: 123,182,381	T344A	possibly damaging	Het
Cenpm	A	T	15: 82,234,373	L180Q	possibly damaging	Het
Cers3	G	T	7: 66,786,075	A261S	probably benign	Het
Dazl	A	G	17: 50,288,133	V91A	probably damaging	Het
Dsc2	C	T	18: 20,051,227	V35I	probably damaging	Het
Fras1	T	C	5: 96,677,385		probably null	Het
Ltbp3	G	A	19: 5,754,022	R854Q	probably benign	Het
Mme	T	A	3: 63,345,192	M419K	probably damaging	Het
Ncan	G	A	8: 70,110,300	T436M	probably benign	Het
Nphp3	G	T	9: 104,003,042	E88*	probably null	Het
Olfr993	T	C	2: 85,414,872	I2M	possibly damaging	Het
Pdcl	T	C	2: 37,352,187	M184V	probably benign	Het
Pramef8	T	A	4: 143,419,318	N452K	probably benign	Het
Prkdc	T	G	16: 15,829,611		probably null	Het
Prss35	A	G	9: 86,755,749	M191V	probably benign	Het
Rtn3	T	C	19: 7,458,145	S142G	probably damaging	Het
Slc19a3	A	T	1: 83,022,957	F113Y	probably damaging	Het
Taf7	A	G	18: 37,643,121	V131A	probably benign	Het
Tesk1	A	G	4: 43,445,133		probably null	Het
Tmem131	C	T	1: 36,818,950	D741N	probably damaging	Het
Tmem63a	G	A	1: 180,963,114	D446N	possibly damaging	Het
Tpte	A	G	8: 22,359,415	S553G	probably damaging	Het
Trpv3	A	T	11: 73,287,420	K438*	probably null	Het
Vmn2r107	G	A	17: 20,375,455	G757R	probably damaging	Het

Other mutations in Polr3b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00787:Polr3b	APN	10	84676990	missense	probably benign
IGL00848:Polr3b	APN	10	84680377	missense	probably damaging	1.00
IGL00901:Polr3b	APN	10	84631796	missense	possibly damaging	0.94
IGL01313:Polr3b	APN	10	84725743	missense	probably damaging	1.00
IGL01364:Polr3b	APN	10	84695669	missense	probably benign	0.00
IGL01731:Polr3b	APN	10	84631840	nonsense	probably null
IGL03326:Polr3b	APN	10	84667395	missense	probably benign	0.43
IGL03369:Polr3b	APN	10	84676952	missense	probably damaging	1.00
etruscan	UTSW	10	84632538	missense	probably benign	0.00
pennyweight	UTSW	10	84713632	missense	probably damaging	1.00
pinhead	UTSW	10	84655991	missense	probably damaging	1.00
G5538:Polr3b	UTSW	10	84631794	missense	probably benign	0.21
PIT4382001:Polr3b	UTSW	10	84684185	missense	probably damaging	1.00
R0180:Polr3b	UTSW	10	84622515	missense	probably benign
R0270:Polr3b	UTSW	10	84718475	missense	probably benign	0.02
R0541:Polr3b	UTSW	10	84638064	missense	probably damaging	1.00
R0890:Polr3b	UTSW	10	84714336	missense	probably benign	0.01
R1302:Polr3b	UTSW	10	84632486	missense	probably damaging	0.97
R1511:Polr3b	UTSW	10	84680385	missense	probably benign
R1561:Polr3b	UTSW	10	84634912	missense	probably damaging	1.00
R1607:Polr3b	UTSW	10	84652783	missense	probably benign	0.00
R1624:Polr3b	UTSW	10	84679805	missense	probably damaging	0.98
R1809:Polr3b	UTSW	10	84693001	missense	probably damaging	1.00
R1830:Polr3b	UTSW	10	84692922	nonsense	probably null
R2973:Polr3b	UTSW	10	84628280	missense	probably benign	0.00
R3401:Polr3b	UTSW	10	84699491	missense	probably damaging	0.96
R3876:Polr3b	UTSW	10	84720518	critical splice donor site	probably null
R4664:Polr3b	UTSW	10	84714369	missense	probably damaging	1.00
R4721:Polr3b	UTSW	10	84656003	missense	possibly damaging	0.56
R4972:Polr3b	UTSW	10	84638124	missense	probably damaging	1.00
R5065:Polr3b	UTSW	10	84632538	missense	probably benign	0.00
R5264:Polr3b	UTSW	10	84667416	missense	probably benign	0.02
R5302:Polr3b	UTSW	10	84699400	missense	possibly damaging	0.59
R5795:Polr3b	UTSW	10	84628252	missense	probably benign
R5795:Polr3b	UTSW	10	84677011	missense	probably damaging	0.97
R5838:Polr3b	UTSW	10	84674590	missense	probably benign	0.09
R6419:Polr3b	UTSW	10	84638111	missense	possibly damaging	0.78
R6568:Polr3b	UTSW	10	84634903	missense	probably damaging	1.00
R6787:Polr3b	UTSW	10	84628625	critical splice acceptor site	probably null
R6913:Polr3b	UTSW	10	84713632	missense	probably damaging	1.00
R7405:Polr3b	UTSW	10	84684179	missense	probably benign
R7456:Polr3b	UTSW	10	84622491	missense	probably benign
R7657:Polr3b	UTSW	10	84655991	missense	probably damaging	1.00
R8074:Polr3b	UTSW	10	84713659	missense	probably damaging	1.00
R8082:Polr3b	UTSW	10	84656063	missense	probably damaging	1.00
R8127:Polr3b	UTSW	10	84679789	missense	probably benign
X0066:Polr3b	UTSW	10	84713695	missense	probably damaging	0.97
Z1177:Polr3b	UTSW	10	84714293	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTGCTTGCTATCTGAACTGC -3'
(R):5'- CTCACACTTTTCAGGGATTTGATG -3'

Sequencing Primer
(F):5'- GCTTGCTATCTGAACTGCTGAAATCG -3'
(R):5'- ACCTGCAACTTTGTTGGCTAAG -3'

Posted On

2015-04-29