Incidental Mutation 'R3961:9930111J21Rik1'
ID312092
Institutional Source Beutler Lab
Gene Symbol 9930111J21Rik1
Ensembl Gene ENSMUSG00000069893
Gene NameRIKEN cDNA 9930111J21 gene 1
Synonyms9930111J21Rik
MMRRC Submission 040836-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R3961 (G1)
Quality Score163
Status Not validated
Chromosome11
Chromosomal Location48946150-48979398 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 48947976 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 595 (T595A)
Ref Sequence ENSEMBL: ENSMUSP00000095102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059930] [ENSMUST00000097494] [ENSMUST00000104958]
Predicted Effect probably benign
Transcript: ENSMUST00000059930
SMART Domains Protein: ENSMUSP00000054351
Gene: ENSMUSG00000048852

DomainStartEndE-ValueType
Pfam:IIGP 27 389 8.4e-123 PFAM
Pfam:MMR_HSR1 63 190 2.2e-9 PFAM
low complexity region 421 432 N/A INTRINSIC
Pfam:IIGP 438 811 3.4e-152 PFAM
Pfam:MMR_HSR1 474 632 1.4e-7 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000097494
AA Change: T595A

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000095102
Gene: ENSMUSG00000069893
AA Change: T595A

DomainStartEndE-ValueType
Pfam:IIGP 36 398 2e-125 PFAM
Pfam:DLIC 52 107 3.2e-5 PFAM
Pfam:MMR_HSR1 72 235 2e-11 PFAM
low complexity region 430 444 N/A INTRINSIC
Pfam:IIGP 447 820 1.9e-153 PFAM
Pfam:MMR_HSR1 483 611 3.6e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000104958
SMART Domains Protein: ENSMUSP00000100564
Gene: ENSMUSG00000078153

DomainStartEndE-ValueType
Pfam:PA28_alpha 11 71 1.2e-26 PFAM
Pfam:PA28_beta 93 237 5.3e-58 PFAM
Meta Mutation Damage Score 0.5383 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 93.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AF529169 G A 9: 89,601,910 T478I probably damaging Het
Bicral T C 17: 46,824,825 I486M probably damaging Het
Btbd1 C A 7: 81,818,335 E146* probably null Het
Cdcp1 T C 9: 123,182,381 T344A possibly damaging Het
Cenpm A T 15: 82,234,373 L180Q possibly damaging Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Dazl A G 17: 50,288,133 V91A probably damaging Het
Dsc2 C T 18: 20,051,227 V35I probably damaging Het
Fras1 T C 5: 96,677,385 probably null Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Mme T A 3: 63,345,192 M419K probably damaging Het
Ncan G A 8: 70,110,300 T436M probably benign Het
Nphp3 G T 9: 104,003,042 E88* probably null Het
Olfr993 T C 2: 85,414,872 I2M possibly damaging Het
Pdcl T C 2: 37,352,187 M184V probably benign Het
Polr3b T C 10: 84,684,302 M694T possibly damaging Het
Pramef8 T A 4: 143,419,318 N452K probably benign Het
Prkdc T G 16: 15,829,611 probably null Het
Prss35 A G 9: 86,755,749 M191V probably benign Het
Rtn3 T C 19: 7,458,145 S142G probably damaging Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Taf7 A G 18: 37,643,121 V131A probably benign Het
Tesk1 A G 4: 43,445,133 probably null Het
Tmem131 C T 1: 36,818,950 D741N probably damaging Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Tpte A G 8: 22,359,415 S553G probably damaging Het
Trpv3 A T 11: 73,287,420 K438* probably null Het
Vmn2r107 G A 17: 20,375,455 G757R probably damaging Het
Other mutations in 9930111J21Rik1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00769:9930111J21Rik1 APN 11 48948212 missense possibly damaging 0.66
IGL02189:9930111J21Rik1 APN 11 48947421 missense probably benign 0.09
IGL02554:9930111J21Rik1 APN 11 48948003 missense probably damaging 1.00
IGL03172:9930111J21Rik1 APN 11 48948176 missense probably damaging 1.00
IGL03334:9930111J21Rik1 APN 11 48947475 missense probably benign 0.09
R0502:9930111J21Rik1 UTSW 11 48947495 missense possibly damaging 0.69
R0503:9930111J21Rik1 UTSW 11 48947495 missense possibly damaging 0.69
R2023:9930111J21Rik1 UTSW 11 48948420 missense possibly damaging 0.51
R3704:9930111J21Rik1 UTSW 11 48947976 missense possibly damaging 0.95
R3705:9930111J21Rik1 UTSW 11 48947976 missense possibly damaging 0.95
R3714:9930111J21Rik1 UTSW 11 48947976 missense possibly damaging 0.95
R3715:9930111J21Rik1 UTSW 11 48947976 missense possibly damaging 0.95
R3962:9930111J21Rik1 UTSW 11 48947976 missense possibly damaging 0.95
R4867:9930111J21Rik1 UTSW 11 48948548 critical splice acceptor site probably null
R5033:9930111J21Rik1 UTSW 11 48947706 missense probably damaging 1.00
R5159:9930111J21Rik1 UTSW 11 48948525 missense probably benign 0.06
R6567:9930111J21Rik1 UTSW 11 48948123 missense probably benign 0.26
R6774:9930111J21Rik1 UTSW 11 48947316 missense possibly damaging 0.94
R7730:9930111J21Rik1 UTSW 11 48947876 missense probably benign 0.19
R7863:9930111J21Rik1 UTSW 11 48947274 missense probably benign 0.18
R8408:9930111J21Rik1 UTSW 11 48948002 missense probably damaging 1.00
X0067:9930111J21Rik1 UTSW 11 48948042 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATGAAGAGGTGGCGCTTG -3'
(R):5'- TTGCCTGGCATTGGGTCTAC -3'

Sequencing Primer
(F):5'- CTCAGTAGGGTGGTCTCCAG -3'
(R):5'- GGTCTACTACCTTCCCACCAC -3'
Posted On2015-04-29