Incidental Mutation 'R3961:Trpv3'
ID312093
Institutional Source Beutler Lab
Gene Symbol Trpv3
Ensembl Gene ENSMUSG00000043029
Gene Nametransient receptor potential cation channel, subfamily V, member 3
SynonymsNh, VRL3, 1110036I10Rik
MMRRC Submission 040836-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R3961 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location73267388-73300363 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 73287420 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 438 (K438*)
Ref Sequence ENSEMBL: ENSMUSP00000053755 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049676]
PDB Structure
Crystal structure of the N-terminal ankyrin repeat domain of TRPV3 [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000049676
AA Change: K438*
SMART Domains Protein: ENSMUSP00000053755
Gene: ENSMUSG00000043029
AA Change: K438*

DomainStartEndE-ValueType
low complexity region 81 92 N/A INTRINSIC
low complexity region 109 122 N/A INTRINSIC
low complexity region 133 153 N/A INTRINSIC
ANK 167 201 1.21e2 SMART
ANK 214 243 3.54e-1 SMART
ANK 261 291 1.36e-2 SMART
ANK 340 370 6.71e-2 SMART
low complexity region 417 431 N/A INTRINSIC
Pfam:Ion_trans 437 689 3.9e-9 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to a family of nonselective cation channels that function in a variety of processes, including temperature sensation and vasoregulation. The thermosensitive members of this family are expressed in subsets of sensory neurons that terminate in the skin, and are activated at distinct physiological temperatures. This channel is activated at temperatures between 22 and 40 degrees C. This gene lies in close proximity to another family member gene on chromosome 17, and the two encoded proteins are thought to associate with each other to form heteromeric channels. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Homozygous null mice have strong deficits in response to innocuous and noxious heat but not in other sensory modalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 T C 11: 48,947,976 T595A possibly damaging Het
AF529169 G A 9: 89,601,910 T478I probably damaging Het
Bicral T C 17: 46,824,825 I486M probably damaging Het
Btbd1 C A 7: 81,818,335 E146* probably null Het
Cdcp1 T C 9: 123,182,381 T344A possibly damaging Het
Cenpm A T 15: 82,234,373 L180Q possibly damaging Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Dazl A G 17: 50,288,133 V91A probably damaging Het
Dsc2 C T 18: 20,051,227 V35I probably damaging Het
Fras1 T C 5: 96,677,385 probably null Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Mme T A 3: 63,345,192 M419K probably damaging Het
Ncan G A 8: 70,110,300 T436M probably benign Het
Nphp3 G T 9: 104,003,042 E88* probably null Het
Olfr993 T C 2: 85,414,872 I2M possibly damaging Het
Pdcl T C 2: 37,352,187 M184V probably benign Het
Polr3b T C 10: 84,684,302 M694T possibly damaging Het
Pramef8 T A 4: 143,419,318 N452K probably benign Het
Prkdc T G 16: 15,829,611 probably null Het
Prss35 A G 9: 86,755,749 M191V probably benign Het
Rtn3 T C 19: 7,458,145 S142G probably damaging Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Taf7 A G 18: 37,643,121 V131A probably benign Het
Tesk1 A G 4: 43,445,133 probably null Het
Tmem131 C T 1: 36,818,950 D741N probably damaging Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Tpte A G 8: 22,359,415 S553G probably damaging Het
Vmn2r107 G A 17: 20,375,455 G757R probably damaging Het
Other mutations in Trpv3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01084:Trpv3 APN 11 73294000 critical splice donor site probably null
IGL01161:Trpv3 APN 11 73296718 splice site probably benign
IGL02130:Trpv3 APN 11 73279770 missense probably benign 0.00
IGL02957:Trpv3 APN 11 73285872 missense probably damaging 1.00
IGL03334:Trpv3 APN 11 73281665 splice site probably benign
R0103:Trpv3 UTSW 11 73293979 missense probably damaging 1.00
R0103:Trpv3 UTSW 11 73293979 missense probably damaging 1.00
R0546:Trpv3 UTSW 11 73297187 missense probably damaging 1.00
R0685:Trpv3 UTSW 11 73296814 splice site probably benign
R0969:Trpv3 UTSW 11 73278938 nonsense probably null
R1748:Trpv3 UTSW 11 73295383 missense possibly damaging 0.84
R1974:Trpv3 UTSW 11 73283688 missense probably damaging 0.99
R2015:Trpv3 UTSW 11 73279827 missense probably damaging 0.97
R3426:Trpv3 UTSW 11 73285941 missense probably damaging 1.00
R3427:Trpv3 UTSW 11 73285941 missense probably damaging 1.00
R3428:Trpv3 UTSW 11 73285941 missense probably damaging 1.00
R3618:Trpv3 UTSW 11 73295455 missense probably damaging 1.00
R3712:Trpv3 UTSW 11 73278954 missense probably benign
R3916:Trpv3 UTSW 11 73283734 missense possibly damaging 0.87
R3917:Trpv3 UTSW 11 73283734 missense possibly damaging 0.87
R4242:Trpv3 UTSW 11 73277823 missense probably benign 0.43
R4277:Trpv3 UTSW 11 73296438 missense probably damaging 0.97
R4506:Trpv3 UTSW 11 73295324 missense probably benign 0.40
R4629:Trpv3 UTSW 11 73281789 missense probably damaging 0.99
R4656:Trpv3 UTSW 11 73295414 missense probably damaging 1.00
R5059:Trpv3 UTSW 11 73295323 missense probably benign 0.00
R5121:Trpv3 UTSW 11 73277834 critical splice donor site probably null
R6113:Trpv3 UTSW 11 73286018 missense probably benign 0.10
R6130:Trpv3 UTSW 11 73296483 missense possibly damaging 0.49
R6342:Trpv3 UTSW 11 73283863 missense probably damaging 1.00
R6850:Trpv3 UTSW 11 73291693 missense probably damaging 1.00
R7180:Trpv3 UTSW 11 73277992 missense probably benign
R7434:Trpv3 UTSW 11 73288261 missense probably damaging 0.96
R7440:Trpv3 UTSW 11 73277974 missense probably benign 0.37
R7741:Trpv3 UTSW 11 73288262 missense probably damaging 0.99
R7750:Trpv3 UTSW 11 73286021 missense probably damaging 0.99
R7785:Trpv3 UTSW 11 73277732 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- GGGCCTTTTGAAAATGGTCC -3'
(R):5'- AATCCTTTATATCTGGGCCTCAG -3'

Sequencing Primer
(F):5'- ACCCATGGTGCTGGCTACATATG -3'
(R):5'- AGTTTCCCCTTCTCTACATGGGG -3'
Posted On2015-04-29