Incidental Mutation 'R3961:Cenpm'
ID312094
Institutional Source Beutler Lab
Gene Symbol Cenpm
Ensembl Gene ENSMUSG00000068101
Gene Namecentromere protein M
Synonyms
MMRRC Submission 040836-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R3961 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location82233779-82244748 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 82234373 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 180 (L180Q)
Ref Sequence ENSEMBL: ENSMUSP00000086560 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089155] [ENSMUST00000089157] [ENSMUST00000230408]
Predicted Effect silent
Transcript: ENSMUST00000089155
SMART Domains Protein: ENSMUSP00000086558
Gene: ENSMUSG00000068101

DomainStartEndE-ValueType
Pfam:CENP-M 1 118 1.7e-56 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000089157
AA Change: L180Q

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000086560
Gene: ENSMUSG00000068101
AA Change: L180Q

DomainStartEndE-ValueType
Pfam:CENP-M 1 172 1.1e-83 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229041
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229505
Predicted Effect probably benign
Transcript: ENSMUST00000230408
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230791
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein that is present in the nucleus of actively growing cells but is excluded from the nucleus during cell division or during growth arrest as a result of contact inhibition. In human, this protein is a component of the CENP-A nucleosome-associated complex that regulates kinetochore protein assembly, mitotic cell-cycle progression, and chromosome segregation. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 T C 11: 48,947,976 T595A possibly damaging Het
AF529169 G A 9: 89,601,910 T478I probably damaging Het
Bicral T C 17: 46,824,825 I486M probably damaging Het
Btbd1 C A 7: 81,818,335 E146* probably null Het
Cdcp1 T C 9: 123,182,381 T344A possibly damaging Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Dazl A G 17: 50,288,133 V91A probably damaging Het
Dsc2 C T 18: 20,051,227 V35I probably damaging Het
Fras1 T C 5: 96,677,385 probably null Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Mme T A 3: 63,345,192 M419K probably damaging Het
Ncan G A 8: 70,110,300 T436M probably benign Het
Nphp3 G T 9: 104,003,042 E88* probably null Het
Olfr993 T C 2: 85,414,872 I2M possibly damaging Het
Pdcl T C 2: 37,352,187 M184V probably benign Het
Polr3b T C 10: 84,684,302 M694T possibly damaging Het
Pramef8 T A 4: 143,419,318 N452K probably benign Het
Prkdc T G 16: 15,829,611 probably null Het
Prss35 A G 9: 86,755,749 M191V probably benign Het
Rtn3 T C 19: 7,458,145 S142G probably damaging Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Taf7 A G 18: 37,643,121 V131A probably benign Het
Tesk1 A G 4: 43,445,133 probably null Het
Tmem131 C T 1: 36,818,950 D741N probably damaging Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Tpte A G 8: 22,359,415 S553G probably damaging Het
Trpv3 A T 11: 73,287,420 K438* probably null Het
Vmn2r107 G A 17: 20,375,455 G757R probably damaging Het
Other mutations in Cenpm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03189:Cenpm APN 15 82234433 missense possibly damaging 0.57
R0801:Cenpm UTSW 15 82234466 missense probably benign 0.36
R1842:Cenpm UTSW 15 82239364 missense probably benign 0.02
R1878:Cenpm UTSW 15 82234415 missense probably benign 0.00
R5409:Cenpm UTSW 15 82234363 missense probably benign
R5525:Cenpm UTSW 15 82239291 critical splice donor site probably null
R7548:Cenpm UTSW 15 82244679 start codon destroyed probably null 1.00
R7562:Cenpm UTSW 15 82241361 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGTTAGACAGGTGCAGATGG -3'
(R):5'- TTCTCAGAGTGTGTCCACCG -3'

Sequencing Primer
(F):5'- ACCTCTGTGGGGTGAGAC -3'
(R):5'- TGTGTCCACCGGGCCAG -3'
Posted On2015-04-29