Mutagenetix > Incidental Mutations

Incidental Mutation 'R3961:Bicral'

312098

Institutional Source

Beutler Lab

Gene Symbol

Bicral

Ensembl Gene

ENSMUSG00000036568

Gene Name

BRD4 interacting chromatin remodeling complex associated protein like

Synonyms

BC032203, Gltscr1l

MMRRC Submission

040836-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R3961 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

46798116-46831413 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 46824825 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Methionine at position 486 (I486M)

Ref Sequence

ENSEMBL: ENSMUSP00000044833 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040624]

Predicted Effect

probably damaging
Transcript: ENSMUST00000040624
AA Change: I486M

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000044833
Gene: ENSMUSG00000036568
AA Change: I486M

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
low complexity region	41	55	N/A	INTRINSIC
low complexity region	204	218	N/A	INTRINSIC
low complexity region	406	417	N/A	INTRINSIC
low complexity region	605	616	N/A	INTRINSIC
Pfam:GLTSCR1	701	808	4.5e-40	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000181301

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 93.9%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a gene trapped allele display abnormal embryo turning, embryonic growth retardation, cardiac hypertrophy, and complete embryonic lethality during organogenesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 28 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930111J21Rik1	T	C	11: 48,947,976	T595A	possibly damaging	Het
AF529169	G	A	9: 89,601,910	T478I	probably damaging	Het
Btbd1	C	A	7: 81,818,335	E146*	probably null	Het
Cdcp1	T	C	9: 123,182,381	T344A	possibly damaging	Het
Cenpm	A	T	15: 82,234,373	L180Q	possibly damaging	Het
Cers3	G	T	7: 66,786,075	A261S	probably benign	Het
Dazl	A	G	17: 50,288,133	V91A	probably damaging	Het
Dsc2	C	T	18: 20,051,227	V35I	probably damaging	Het
Fras1	T	C	5: 96,677,385		probably null	Het
Ltbp3	G	A	19: 5,754,022	R854Q	probably benign	Het
Mme	T	A	3: 63,345,192	M419K	probably damaging	Het
Ncan	G	A	8: 70,110,300	T436M	probably benign	Het
Nphp3	G	T	9: 104,003,042	E88*	probably null	Het
Olfr993	T	C	2: 85,414,872	I2M	possibly damaging	Het
Pdcl	T	C	2: 37,352,187	M184V	probably benign	Het
Polr3b	T	C	10: 84,684,302	M694T	possibly damaging	Het
Pramef8	T	A	4: 143,419,318	N452K	probably benign	Het
Prkdc	T	G	16: 15,829,611		probably null	Het
Prss35	A	G	9: 86,755,749	M191V	probably benign	Het
Rtn3	T	C	19: 7,458,145	S142G	probably damaging	Het
Slc19a3	A	T	1: 83,022,957	F113Y	probably damaging	Het
Taf7	A	G	18: 37,643,121	V131A	probably benign	Het
Tesk1	A	G	4: 43,445,133		probably null	Het
Tmem131	C	T	1: 36,818,950	D741N	probably damaging	Het
Tmem63a	G	A	1: 180,963,114	D446N	possibly damaging	Het
Tpte	A	G	8: 22,359,415	S553G	probably damaging	Het
Trpv3	A	T	11: 73,287,420	K438*	probably null	Het
Vmn2r107	G	A	17: 20,375,455	G757R	probably damaging	Het

Other mutations in Bicral

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00547:Bicral	APN	17	46825352	missense	probably benign	0.01
IGL01068:Bicral	APN	17	46825391	missense	probably damaging	1.00
IGL01899:Bicral	APN	17	46824674	missense	probably benign	0.08
IGL02321:Bicral	APN	17	46811947	missense	probably benign	0.01
IGL02425:Bicral	APN	17	46808454	missense	probably benign	0.05
R0091:Bicral	UTSW	17	46825307	missense	probably damaging	1.00
R0268:Bicral	UTSW	17	46814052	splice site	probably benign
R0344:Bicral	UTSW	17	46814052	splice site	probably benign
R0508:Bicral	UTSW	17	46825401	missense	possibly damaging	0.61
R0589:Bicral	UTSW	17	46801596	missense	probably benign	0.00
R1442:Bicral	UTSW	17	46801724	missense	probably benign	0.05
R1468:Bicral	UTSW	17	46824593	missense	probably benign	0.00
R1468:Bicral	UTSW	17	46824593	missense	probably benign	0.00
R1874:Bicral	UTSW	17	46825178	missense	probably benign	0.30
R2057:Bicral	UTSW	17	46824888	missense	possibly damaging	0.69
R2120:Bicral	UTSW	17	46824815	missense	probably benign	0.02
R2190:Bicral	UTSW	17	46825123	missense	probably damaging	0.98
R3737:Bicral	UTSW	17	46825910	missense	probably damaging	1.00
R3977:Bicral	UTSW	17	46830991	start codon destroyed	unknown
R3979:Bicral	UTSW	17	46830991	start codon destroyed	unknown
R4183:Bicral	UTSW	17	46814029	missense	probably damaging	1.00
R4876:Bicral	UTSW	17	46825576	missense	probably damaging	1.00
R5104:Bicral	UTSW	17	46801256	missense	probably damaging	0.98
R5310:Bicral	UTSW	17	46813983	missense	possibly damaging	0.89
R5493:Bicral	UTSW	17	46801694	missense	possibly damaging	0.77
R5610:Bicral	UTSW	17	46808492	missense	probably damaging	0.99
R5656:Bicral	UTSW	17	46808369	missense	probably damaging	0.99
R5771:Bicral	UTSW	17	46825358	missense	possibly damaging	0.59
R5891:Bicral	UTSW	17	46801229	missense	probably benign
R6426:Bicral	UTSW	17	46830079	missense	probably benign	0.36
R6497:Bicral	UTSW	17	46825573	missense	probably damaging	1.00
R7025:Bicral	UTSW	17	46801668	missense	probably benign
R7037:Bicral	UTSW	17	46824634	missense	probably benign	0.08
R7440:Bicral	UTSW	17	46825784	missense	probably damaging	1.00
R7997:Bicral	UTSW	17	46801608	missense	probably benign	0.37
V3553:Bicral	UTSW	17	46830095	missense	probably damaging	1.00
X0019:Bicral	UTSW	17	46825821	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GATGAGCAGTGCTAGCTGAG -3'
(R):5'- CATGTCCAGGCTATAAACGGG -3'

Sequencing Primer
(F):5'- CTAGCTGAGCTGACGGC -3'
(R):5'- TATAAACGGGCAGCTGCTTC -3'

Posted On

2015-04-29