Incidental Mutation 'R3961:Bicral'
ID312098
Institutional Source Beutler Lab
Gene Symbol Bicral
Ensembl Gene ENSMUSG00000036568
Gene NameBRD4 interacting chromatin remodeling complex associated protein like
SynonymsBC032203, Gltscr1l
MMRRC Submission 040836-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3961 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location46798116-46831413 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46824825 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 486 (I486M)
Ref Sequence ENSEMBL: ENSMUSP00000044833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040624]
Predicted Effect probably damaging
Transcript: ENSMUST00000040624
AA Change: I486M

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000044833
Gene: ENSMUSG00000036568
AA Change: I486M

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 41 55 N/A INTRINSIC
low complexity region 204 218 N/A INTRINSIC
low complexity region 406 417 N/A INTRINSIC
low complexity region 605 616 N/A INTRINSIC
Pfam:GLTSCR1 701 808 4.5e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181301
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele display abnormal embryo turning, embryonic growth retardation, cardiac hypertrophy, and complete embryonic lethality during organogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 T C 11: 48,947,976 T595A possibly damaging Het
AF529169 G A 9: 89,601,910 T478I probably damaging Het
Btbd1 C A 7: 81,818,335 E146* probably null Het
Cdcp1 T C 9: 123,182,381 T344A possibly damaging Het
Cenpm A T 15: 82,234,373 L180Q possibly damaging Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Dazl A G 17: 50,288,133 V91A probably damaging Het
Dsc2 C T 18: 20,051,227 V35I probably damaging Het
Fras1 T C 5: 96,677,385 probably null Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Mme T A 3: 63,345,192 M419K probably damaging Het
Ncan G A 8: 70,110,300 T436M probably benign Het
Nphp3 G T 9: 104,003,042 E88* probably null Het
Olfr993 T C 2: 85,414,872 I2M possibly damaging Het
Pdcl T C 2: 37,352,187 M184V probably benign Het
Polr3b T C 10: 84,684,302 M694T possibly damaging Het
Pramef8 T A 4: 143,419,318 N452K probably benign Het
Prkdc T G 16: 15,829,611 probably null Het
Prss35 A G 9: 86,755,749 M191V probably benign Het
Rtn3 T C 19: 7,458,145 S142G probably damaging Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Taf7 A G 18: 37,643,121 V131A probably benign Het
Tesk1 A G 4: 43,445,133 probably null Het
Tmem131 C T 1: 36,818,950 D741N probably damaging Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Tpte A G 8: 22,359,415 S553G probably damaging Het
Trpv3 A T 11: 73,287,420 K438* probably null Het
Vmn2r107 G A 17: 20,375,455 G757R probably damaging Het
Other mutations in Bicral
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Bicral APN 17 46825352 missense probably benign 0.01
IGL01068:Bicral APN 17 46825391 missense probably damaging 1.00
IGL01899:Bicral APN 17 46824674 missense probably benign 0.08
IGL02321:Bicral APN 17 46811947 missense probably benign 0.01
IGL02425:Bicral APN 17 46808454 missense probably benign 0.05
R0091:Bicral UTSW 17 46825307 missense probably damaging 1.00
R0268:Bicral UTSW 17 46814052 splice site probably benign
R0344:Bicral UTSW 17 46814052 splice site probably benign
R0508:Bicral UTSW 17 46825401 missense possibly damaging 0.61
R0589:Bicral UTSW 17 46801596 missense probably benign 0.00
R1442:Bicral UTSW 17 46801724 missense probably benign 0.05
R1468:Bicral UTSW 17 46824593 missense probably benign 0.00
R1468:Bicral UTSW 17 46824593 missense probably benign 0.00
R1874:Bicral UTSW 17 46825178 missense probably benign 0.30
R2057:Bicral UTSW 17 46824888 missense possibly damaging 0.69
R2120:Bicral UTSW 17 46824815 missense probably benign 0.02
R2190:Bicral UTSW 17 46825123 missense probably damaging 0.98
R3737:Bicral UTSW 17 46825910 missense probably damaging 1.00
R3977:Bicral UTSW 17 46830991 start codon destroyed unknown
R3979:Bicral UTSW 17 46830991 start codon destroyed unknown
R4183:Bicral UTSW 17 46814029 missense probably damaging 1.00
R4876:Bicral UTSW 17 46825576 missense probably damaging 1.00
R5104:Bicral UTSW 17 46801256 missense probably damaging 0.98
R5310:Bicral UTSW 17 46813983 missense possibly damaging 0.89
R5493:Bicral UTSW 17 46801694 missense possibly damaging 0.77
R5610:Bicral UTSW 17 46808492 missense probably damaging 0.99
R5656:Bicral UTSW 17 46808369 missense probably damaging 0.99
R5771:Bicral UTSW 17 46825358 missense possibly damaging 0.59
R5891:Bicral UTSW 17 46801229 missense probably benign
R6426:Bicral UTSW 17 46830079 missense probably benign 0.36
R6497:Bicral UTSW 17 46825573 missense probably damaging 1.00
R7025:Bicral UTSW 17 46801668 missense probably benign
R7037:Bicral UTSW 17 46824634 missense probably benign 0.08
R7440:Bicral UTSW 17 46825784 missense probably damaging 1.00
R7997:Bicral UTSW 17 46801608 missense probably benign 0.37
V3553:Bicral UTSW 17 46830095 missense probably damaging 1.00
X0019:Bicral UTSW 17 46825821 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GATGAGCAGTGCTAGCTGAG -3'
(R):5'- CATGTCCAGGCTATAAACGGG -3'

Sequencing Primer
(F):5'- CTAGCTGAGCTGACGGC -3'
(R):5'- TATAAACGGGCAGCTGCTTC -3'
Posted On2015-04-29