Incidental Mutation 'R3961:Taf7'
ID312101
Institutional Source Beutler Lab
Gene Symbol Taf7
Ensembl Gene ENSMUSG00000051316
Gene NameTATA-box binding protein associated factor 7
Synonyms55kDa, Taf2f, TAFII55
MMRRC Submission 040836-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3961 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location37640491-37644204 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37643121 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 131 (V131A)
Ref Sequence ENSEMBL: ENSMUSP00000065645 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058635] [ENSMUST00000066272] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably benign
Transcript: ENSMUST00000058635
SMART Domains Protein: ENSMUSP00000052849
Gene: ENSMUSG00000050304

DomainStartEndE-ValueType
Pfam:Mito_carr 1 60 5.9e-11 PFAM
Pfam:Mito_carr 67 165 9.5e-20 PFAM
Pfam:Mito_carr 169 262 8.9e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000066272
AA Change: V131A

PolyPhen 2 Score 0.292 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000065645
Gene: ENSMUSG00000051316
AA Change: V131A

DomainStartEndE-ValueType
TAFII55_N 12 178 4.63e-94 SMART
low complexity region 225 235 N/A INTRINSIC
coiled coil region 237 341 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The intronless gene for this transcription coactivator is located between the protocadherin beta and gamma gene clusters on chromosome 5. The protein encoded by this gene is a component of the TFIID protein complex, a complex which binds to the TATA box in class II promoters and recruits RNA polymerase II and other factors. This particular subunit interacts with the largest TFIID subunit, as well as multiple transcription activators. The protein is required for transcription by promoters targeted by RNA polymerase II. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality between E3.5 and E5.5. Mice homozygous for a conditional allele activated in thymocytes exhibit impaired T cell differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 T C 11: 48,947,976 T595A possibly damaging Het
AF529169 G A 9: 89,601,910 T478I probably damaging Het
Bicral T C 17: 46,824,825 I486M probably damaging Het
Btbd1 C A 7: 81,818,335 E146* probably null Het
Cdcp1 T C 9: 123,182,381 T344A possibly damaging Het
Cenpm A T 15: 82,234,373 L180Q possibly damaging Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Dazl A G 17: 50,288,133 V91A probably damaging Het
Dsc2 C T 18: 20,051,227 V35I probably damaging Het
Fras1 T C 5: 96,677,385 probably null Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Mme T A 3: 63,345,192 M419K probably damaging Het
Ncan G A 8: 70,110,300 T436M probably benign Het
Nphp3 G T 9: 104,003,042 E88* probably null Het
Olfr993 T C 2: 85,414,872 I2M possibly damaging Het
Pdcl T C 2: 37,352,187 M184V probably benign Het
Polr3b T C 10: 84,684,302 M694T possibly damaging Het
Pramef8 T A 4: 143,419,318 N452K probably benign Het
Prkdc T G 16: 15,829,611 probably null Het
Prss35 A G 9: 86,755,749 M191V probably benign Het
Rtn3 T C 19: 7,458,145 S142G probably damaging Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Tesk1 A G 4: 43,445,133 probably null Het
Tmem131 C T 1: 36,818,950 D741N probably damaging Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Tpte A G 8: 22,359,415 S553G probably damaging Het
Trpv3 A T 11: 73,287,420 K438* probably null Het
Vmn2r107 G A 17: 20,375,455 G757R probably damaging Het
Other mutations in Taf7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01061:Taf7 APN 18 37643433 missense probably damaging 1.00
IGL02123:Taf7 APN 18 37642480 intron probably benign
IGL02155:Taf7 APN 18 37643511 start codon destroyed probably null 0.95
IGL02291:Taf7 APN 18 37643362 missense possibly damaging 0.76
R4590:Taf7 UTSW 18 37642731 missense possibly damaging 0.75
R5629:Taf7 UTSW 18 37643502 missense probably benign
R5982:Taf7 UTSW 18 37643445 missense probably damaging 1.00
R6492:Taf7 UTSW 18 37643106 missense probably damaging 1.00
R6896:Taf7 UTSW 18 37642680 missense possibly damaging 0.88
R6944:Taf7 UTSW 18 37642857 missense probably damaging 1.00
R7154:Taf7 UTSW 18 37642548 missense possibly damaging 0.57
R7174:Taf7 UTSW 18 37643000 missense probably damaging 1.00
R8371:Taf7 UTSW 18 37643499 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATTCCTGGAGAAGAGATGTCC -3'
(R):5'- TTGCCTTGTGTTACGGAAAGC -3'

Sequencing Primer
(F):5'- AAGAGATGTCCAGGCCTTGATTTTC -3'
(R):5'- GTGTTACGGAAAGCTTGAAAACCATC -3'
Posted On2015-04-29