Incidental Mutation 'R3962:Abca12'
ID312106
Institutional Source Beutler Lab
Gene Symbol Abca12
Ensembl Gene ENSMUSG00000050296
Gene NameATP-binding cassette, sub-family A (ABC1), member 12
Synonyms4833417A11Rik, 4832428G11Rik
MMRRC Submission 040837-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3962 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location71242276-71414910 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 71274515 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000084523 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087268] [ENSMUST00000087268] [ENSMUST00000087268]
Predicted Effect probably null
Transcript: ENSMUST00000087268
SMART Domains Protein: ENSMUSP00000084523
Gene: ENSMUSG00000050296

DomainStartEndE-ValueType
transmembrane domain 24 43 N/A INTRINSIC
low complexity region 246 259 N/A INTRINSIC
Pfam:ABC2_membrane_3 885 1267 2.9e-24 PFAM
AAA 1370 1554 4.2e-10 SMART
low complexity region 1717 1735 N/A INTRINSIC
Pfam:ABC2_membrane_3 1744 2206 9.6e-35 PFAM
AAA 2282 2467 4.61e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000087268
SMART Domains Protein: ENSMUSP00000084523
Gene: ENSMUSG00000050296

DomainStartEndE-ValueType
transmembrane domain 24 43 N/A INTRINSIC
low complexity region 246 259 N/A INTRINSIC
Pfam:ABC2_membrane_3 885 1267 2.9e-24 PFAM
AAA 1370 1554 4.2e-10 SMART
low complexity region 1717 1735 N/A INTRINSIC
Pfam:ABC2_membrane_3 1744 2206 9.6e-35 PFAM
AAA 2282 2467 4.61e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000087268
SMART Domains Protein: ENSMUSP00000084523
Gene: ENSMUSG00000050296

DomainStartEndE-ValueType
transmembrane domain 24 43 N/A INTRINSIC
low complexity region 246 259 N/A INTRINSIC
Pfam:ABC2_membrane_3 885 1267 2.9e-24 PFAM
AAA 1370 1554 4.2e-10 SMART
low complexity region 1717 1735 N/A INTRINSIC
Pfam:ABC2_membrane_3 1744 2206 9.6e-35 PFAM
AAA 2282 2467 4.61e-7 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 93.9%
Validation Efficiency 96% (48/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This encoded protein is a member of the ABC1 subfamily, which is the only major ABC subfamily found exclusively in multicellular eukaryotes. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality associated with defective skin development and abnormal lung morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik A G 19: 58,789,109 Y82H probably damaging Het
9930111J21Rik1 T C 11: 48,947,976 T595A possibly damaging Het
Ablim2 C T 5: 35,812,175 R211C probably damaging Het
Actn4 C A 7: 28,898,222 probably null Het
AF529169 G A 9: 89,601,910 T478I probably damaging Het
B3gnt5 A G 16: 19,769,048 S6G probably benign Het
Bod1l T G 5: 41,808,721 E2667A probably benign Het
Ccdc13 G A 9: 121,798,939 probably benign Het
Ccdc15 G T 9: 37,320,486 R181S probably damaging Het
Ccnd1 G A 7: 144,934,050 T230M probably damaging Het
Cdcp1 T C 9: 123,182,381 T344A possibly damaging Het
Fam161a T C 11: 23,023,507 M275T possibly damaging Het
Fbxo15 A G 18: 84,959,247 T95A probably benign Het
Fndc5 T C 4: 129,139,895 V152A probably benign Het
Galk2 A T 2: 125,893,373 N107I probably benign Het
Glmn A T 5: 107,561,045 probably benign Het
Gm5082 T C 13: 41,656,418 noncoding transcript Het
Gm5828 C T 1: 16,768,644 noncoding transcript Het
Haus6 C T 4: 86,611,804 A4T possibly damaging Het
Hmgcs2 G A 3: 98,291,038 V86M possibly damaging Het
Hrg G A 16: 22,956,075 V152I possibly damaging Het
Itga2 A T 13: 114,839,518 V1106E probably damaging Het
Itga9 G A 9: 118,628,186 D122N possibly damaging Het
Kif21a T A 15: 90,985,409 E413V probably damaging Het
Klk1 A G 7: 44,229,549 T256A possibly damaging Het
L1td1 T C 4: 98,737,449 V627A probably benign Het
Larp4 C A 15: 100,012,145 Q652K probably damaging Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Moxd2 T A 6: 40,885,397 M163L probably benign Het
Myo15 G A 11: 60,479,828 R1138H probably benign Het
Oasl2 A G 5: 114,897,747 D28G probably benign Het
Olfr777 A T 10: 129,268,666 I219N probably damaging Het
Platr26 A T 2: 71,719,505 noncoding transcript Het
Ptdss1 A G 13: 66,994,011 H411R probably benign Het
Ptpa A G 2: 30,435,660 T147A probably damaging Het
Rfx2 T C 17: 56,785,302 Y307C probably damaging Het
Rtn3 T C 19: 7,458,145 S142G probably damaging Het
Shisa6 A G 11: 66,217,476 V525A probably damaging Het
Slc4a3 A G 1: 75,556,754 S1007G probably damaging Het
Srsf3 C T 17: 29,036,456 probably benign Het
Taar8a A G 10: 24,077,156 I219M probably damaging Het
Tars2 A G 3: 95,754,756 probably null Het
Tfap2d A G 1: 19,118,965 N245S probably damaging Het
Tlr6 T A 5: 64,954,985 H193L probably benign Het
Tomm20l T C 12: 71,117,578 V78A probably benign Het
Tsc2 G A 17: 24,621,166 probably benign Het
Usp2 A G 9: 44,075,657 D84G possibly damaging Het
V1ra8 A G 6: 90,203,484 N223S probably benign Het
Wnk2 C A 13: 49,070,977 R1122L probably damaging Het
Other mutations in Abca12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Abca12 APN 1 71303541 missense possibly damaging 0.64
IGL00556:Abca12 APN 1 71353757 missense probably benign 0.00
IGL00813:Abca12 APN 1 71353762 critical splice acceptor site probably null
IGL00835:Abca12 APN 1 71302733 missense probably damaging 1.00
IGL00921:Abca12 APN 1 71285729 missense probably damaging 1.00
IGL01011:Abca12 APN 1 71263632 missense probably benign 0.02
IGL01066:Abca12 APN 1 71353730 missense possibly damaging 0.95
IGL01082:Abca12 APN 1 71314114 missense probably damaging 1.00
IGL01310:Abca12 APN 1 71284156 missense probably benign 0.00
IGL01360:Abca12 APN 1 71286489 missense possibly damaging 0.95
IGL01585:Abca12 APN 1 71319886 missense probably benign 0.00
IGL01608:Abca12 APN 1 71259442 missense probably damaging 1.00
IGL01687:Abca12 APN 1 71267610 splice site probably benign
IGL01700:Abca12 APN 1 71280390 missense probably benign
IGL01723:Abca12 APN 1 71314168 missense probably benign 0.01
IGL01804:Abca12 APN 1 71276183 missense probably benign 0.01
IGL01982:Abca12 APN 1 71346698 missense probably benign 0.34
IGL02136:Abca12 APN 1 71247142 missense probably damaging 1.00
IGL02172:Abca12 APN 1 71302658 missense probably benign 0.09
IGL02222:Abca12 APN 1 71282886 missense probably benign 0.40
IGL02266:Abca12 APN 1 71268201 nonsense probably null
IGL02449:Abca12 APN 1 71401749 splice site probably null
IGL02471:Abca12 APN 1 71258198 missense probably benign 0.00
IGL02496:Abca12 APN 1 71288553 missense possibly damaging 0.55
IGL02552:Abca12 APN 1 71294747 missense probably damaging 0.96
IGL02795:Abca12 APN 1 71288748 missense probably damaging 1.00
IGL03000:Abca12 APN 1 71321800 missense probably benign 0.01
IGL03031:Abca12 APN 1 71314024 missense probably benign 0.00
IGL03131:Abca12 APN 1 71346702 missense probably benign
IGL03260:Abca12 APN 1 71284099 missense probably damaging 1.00
IGL03324:Abca12 APN 1 71314008 missense probably benign
IGL03408:Abca12 APN 1 71264795 missense probably damaging 1.00
R0016:Abca12 UTSW 1 71294800 missense probably benign 0.35
R0016:Abca12 UTSW 1 71294800 missense probably benign 0.35
R0121:Abca12 UTSW 1 71259786 splice site probably null
R0172:Abca12 UTSW 1 71279402 missense probably damaging 0.99
R0196:Abca12 UTSW 1 71259813 missense possibly damaging 0.81
R0400:Abca12 UTSW 1 71259776 splice site probably benign
R0466:Abca12 UTSW 1 71302663 missense probably damaging 1.00
R0616:Abca12 UTSW 1 71302671 missense probably damaging 1.00
R0668:Abca12 UTSW 1 71263614 missense probably damaging 1.00
R0928:Abca12 UTSW 1 71349174 missense probably benign 0.06
R1036:Abca12 UTSW 1 71263410 critical splice donor site probably null
R1086:Abca12 UTSW 1 71295061 splice site probably benign
R1300:Abca12 UTSW 1 71244808 missense probably damaging 1.00
R1337:Abca12 UTSW 1 71294819 missense probably benign 0.03
R1356:Abca12 UTSW 1 71302953 splice site probably benign
R1372:Abca12 UTSW 1 71294857 missense probably damaging 1.00
R1434:Abca12 UTSW 1 71309800 missense probably benign 0.00
R1580:Abca12 UTSW 1 71265965 missense possibly damaging 0.65
R1675:Abca12 UTSW 1 71263411 critical splice donor site probably null
R1773:Abca12 UTSW 1 71288596 missense probably damaging 1.00
R1829:Abca12 UTSW 1 71295029 missense probably benign 0.26
R1922:Abca12 UTSW 1 71319924 missense probably benign 0.10
R1927:Abca12 UTSW 1 71244840 missense probably damaging 1.00
R2115:Abca12 UTSW 1 71244771 missense probably benign 0.01
R2146:Abca12 UTSW 1 71263488 missense probably benign 0.02
R2148:Abca12 UTSW 1 71263488 missense probably benign 0.02
R2149:Abca12 UTSW 1 71263488 missense probably benign 0.02
R2150:Abca12 UTSW 1 71263488 missense probably benign 0.02
R2299:Abca12 UTSW 1 71258222 missense probably damaging 1.00
R2392:Abca12 UTSW 1 71258105 missense probably damaging 1.00
R2571:Abca12 UTSW 1 71249885 missense probably benign 0.00
R3077:Abca12 UTSW 1 71267605 missense probably benign 0.02
R3078:Abca12 UTSW 1 71267605 missense probably benign 0.02
R3705:Abca12 UTSW 1 71285705 missense probably damaging 1.00
R3800:Abca12 UTSW 1 71265887 missense probably damaging 1.00
R3905:Abca12 UTSW 1 71268230 missense possibly damaging 0.79
R3905:Abca12 UTSW 1 71279457 missense probably benign 0.02
R4082:Abca12 UTSW 1 71267463 missense possibly damaging 0.64
R4131:Abca12 UTSW 1 71319871 critical splice donor site probably null
R4214:Abca12 UTSW 1 71288697 missense probably damaging 0.99
R4403:Abca12 UTSW 1 71267436 missense probably damaging 1.00
R4524:Abca12 UTSW 1 71302917 missense probably benign 0.19
R4615:Abca12 UTSW 1 71330334 missense probably benign
R4617:Abca12 UTSW 1 71330334 missense probably benign
R4714:Abca12 UTSW 1 71321450 missense probably benign 0.00
R4809:Abca12 UTSW 1 71278856 missense probably benign 0.10
R4810:Abca12 UTSW 1 71303612 missense probably benign 0.00
R4825:Abca12 UTSW 1 71302685 missense possibly damaging 0.70
R4990:Abca12 UTSW 1 71294939 missense possibly damaging 0.61
R5013:Abca12 UTSW 1 71264767 missense probably damaging 0.99
R5026:Abca12 UTSW 1 71317224 missense probably benign 0.04
R5064:Abca12 UTSW 1 71300960 missense probably damaging 1.00
R5188:Abca12 UTSW 1 71291492 missense probably benign 0.23
R5234:Abca12 UTSW 1 71263664 missense probably damaging 0.99
R5267:Abca12 UTSW 1 71335774 splice site probably benign
R5302:Abca12 UTSW 1 71283952 missense possibly damaging 0.91
R5441:Abca12 UTSW 1 71295056 missense probably damaging 1.00
R5451:Abca12 UTSW 1 71294917 missense possibly damaging 0.94
R5526:Abca12 UTSW 1 71292446 missense probably benign 0.29
R5529:Abca12 UTSW 1 71264881 missense probably damaging 1.00
R5615:Abca12 UTSW 1 71307059 missense probably damaging 1.00
R5649:Abca12 UTSW 1 71291342 missense probably damaging 1.00
R5800:Abca12 UTSW 1 71321432 missense possibly damaging 0.78
R5807:Abca12 UTSW 1 71303492 missense probably damaging 1.00
R5878:Abca12 UTSW 1 71346633 missense possibly damaging 0.79
R5987:Abca12 UTSW 1 71258098 missense probably damaging 1.00
R6280:Abca12 UTSW 1 71272460 missense probably benign 0.04
R6316:Abca12 UTSW 1 71313959 missense probably benign 0.01
R6337:Abca12 UTSW 1 71295013 missense probably damaging 1.00
R6383:Abca12 UTSW 1 71247184 missense probably benign 0.03
R6564:Abca12 UTSW 1 71309850 missense possibly damaging 0.57
R6582:Abca12 UTSW 1 71258225 missense probably benign 0.00
R6756:Abca12 UTSW 1 71259353 splice site probably null
R6876:Abca12 UTSW 1 71263508 missense probably damaging 0.98
R6999:Abca12 UTSW 1 71317162 nonsense probably null
R7145:Abca12 UTSW 1 71307053 missense possibly damaging 0.92
R7272:Abca12 UTSW 1 71248432 missense probably damaging 0.99
R7285:Abca12 UTSW 1 71349155 nonsense probably null
R7421:Abca12 UTSW 1 71247136 nonsense probably null
R7531:Abca12 UTSW 1 71247173 missense probably damaging 0.99
R7592:Abca12 UTSW 1 71288677 missense probably benign 0.01
R7687:Abca12 UTSW 1 71258182 missense probably benign 0.00
R7690:Abca12 UTSW 1 71314154 missense probably benign 0.00
R7709:Abca12 UTSW 1 71335728 missense probably benign 0.00
R7736:Abca12 UTSW 1 71319964 missense probably benign 0.01
R7754:Abca12 UTSW 1 71302887 missense probably benign
R7761:Abca12 UTSW 1 71330288 missense probably damaging 1.00
R7816:Abca12 UTSW 1 71292429 missense probably benign 0.01
R7821:Abca12 UTSW 1 71259791 missense probably benign 0.12
R7827:Abca12 UTSW 1 71414678 start gained probably benign
R7829:Abca12 UTSW 1 71292421 missense probably benign 0.37
R7863:Abca12 UTSW 1 71293497 missense probably damaging 0.96
R7946:Abca12 UTSW 1 71293497 missense probably damaging 0.96
X0013:Abca12 UTSW 1 71248433 missense probably damaging 0.99
X0018:Abca12 UTSW 1 71314510 missense probably benign
X0063:Abca12 UTSW 1 71349064 missense probably benign 0.15
X0065:Abca12 UTSW 1 71341461 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCACCACACAGAATTGATTTTG -3'
(R):5'- CTGAGACTCTTGCCTTTAGTAATGAC -3'

Sequencing Primer
(F):5'- TGTTTTATGTTTCTCACATGAAAGTG -3'
(R):5'- CTCTTGCCTTTAGTAATGACATACAC -3'
Posted On2015-04-29