Incidental Mutation 'R3962:Hmgcs2'
ID312113
Institutional Source Beutler Lab
Gene Symbol Hmgcs2
Ensembl Gene ENSMUSG00000027875
Gene Name3-hydroxy-3-methylglutaryl-Coenzyme A synthase 2
SynonymsmHS
MMRRC Submission 040837-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R3962 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location98280435-98310738 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 98291038 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 86 (V86M)
Ref Sequence ENSEMBL: ENSMUSP00000113296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090746] [ENSMUST00000120541]
Predicted Effect possibly damaging
Transcript: ENSMUST00000090746
AA Change: V86M

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000088249
Gene: ENSMUSG00000027875
AA Change: V86M

DomainStartEndE-ValueType
Pfam:HMG_CoA_synt_N 50 223 2.9e-111 PFAM
Pfam:HMG_CoA_synt_C 224 506 6.6e-131 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000120541
AA Change: V86M

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113296
Gene: ENSMUSG00000027875
AA Change: V86M

DomainStartEndE-ValueType
Pfam:HMG_CoA_synt_N 50 223 7.2e-108 PFAM
Pfam:HMG_CoA_synt_C 224 506 1.8e-131 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196040
Meta Mutation Damage Score 0.4157 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 93.9%
Validation Efficiency 96% (48/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the HMG-CoA synthase family. It is a mitochondrial enzyme that catalyzes the first reaction of ketogenesis, a metabolic pathway that provides lipid-derived energy for various organs during times of carbohydrate deprivation, such as fasting. Mutations in this gene are associated with HMG-CoA synthase deficiency. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik A G 19: 58,789,109 Y82H probably damaging Het
9930111J21Rik1 T C 11: 48,947,976 T595A possibly damaging Het
Abca12 A T 1: 71,274,515 probably null Het
Ablim2 C T 5: 35,812,175 R211C probably damaging Het
Actn4 C A 7: 28,898,222 probably null Het
AF529169 G A 9: 89,601,910 T478I probably damaging Het
B3gnt5 A G 16: 19,769,048 S6G probably benign Het
Bod1l T G 5: 41,808,721 E2667A probably benign Het
Ccdc13 G A 9: 121,798,939 probably benign Het
Ccdc15 G T 9: 37,320,486 R181S probably damaging Het
Ccnd1 G A 7: 144,934,050 T230M probably damaging Het
Cdcp1 T C 9: 123,182,381 T344A possibly damaging Het
Fam161a T C 11: 23,023,507 M275T possibly damaging Het
Fbxo15 A G 18: 84,959,247 T95A probably benign Het
Fndc5 T C 4: 129,139,895 V152A probably benign Het
Galk2 A T 2: 125,893,373 N107I probably benign Het
Glmn A T 5: 107,561,045 probably benign Het
Gm5082 T C 13: 41,656,418 noncoding transcript Het
Gm5828 C T 1: 16,768,644 noncoding transcript Het
Haus6 C T 4: 86,611,804 A4T possibly damaging Het
Hrg G A 16: 22,956,075 V152I possibly damaging Het
Itga2 A T 13: 114,839,518 V1106E probably damaging Het
Itga9 G A 9: 118,628,186 D122N possibly damaging Het
Kif21a T A 15: 90,985,409 E413V probably damaging Het
Klk1 A G 7: 44,229,549 T256A possibly damaging Het
L1td1 T C 4: 98,737,449 V627A probably benign Het
Larp4 C A 15: 100,012,145 Q652K probably damaging Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Moxd2 T A 6: 40,885,397 M163L probably benign Het
Myo15 G A 11: 60,479,828 R1138H probably benign Het
Oasl2 A G 5: 114,897,747 D28G probably benign Het
Olfr777 A T 10: 129,268,666 I219N probably damaging Het
Platr26 A T 2: 71,719,505 noncoding transcript Het
Ptdss1 A G 13: 66,994,011 H411R probably benign Het
Ptpa A G 2: 30,435,660 T147A probably damaging Het
Rfx2 T C 17: 56,785,302 Y307C probably damaging Het
Rtn3 T C 19: 7,458,145 S142G probably damaging Het
Shisa6 A G 11: 66,217,476 V525A probably damaging Het
Slc4a3 A G 1: 75,556,754 S1007G probably damaging Het
Srsf3 C T 17: 29,036,456 probably benign Het
Taar8a A G 10: 24,077,156 I219M probably damaging Het
Tars2 A G 3: 95,754,756 probably null Het
Tfap2d A G 1: 19,118,965 N245S probably damaging Het
Tlr6 T A 5: 64,954,985 H193L probably benign Het
Tomm20l T C 12: 71,117,578 V78A probably benign Het
Tsc2 G A 17: 24,621,166 probably benign Het
Usp2 A G 9: 44,075,657 D84G possibly damaging Het
V1ra8 A G 6: 90,203,484 N223S probably benign Het
Wnk2 C A 13: 49,070,977 R1122L probably damaging Het
Other mutations in Hmgcs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0579:Hmgcs2 UTSW 3 98290948 missense probably damaging 1.00
R0657:Hmgcs2 UTSW 3 98291053 missense probably benign
R0724:Hmgcs2 UTSW 3 98297001 nonsense probably null
R2024:Hmgcs2 UTSW 3 98299214 missense probably damaging 1.00
R2109:Hmgcs2 UTSW 3 98297021 nonsense probably null
R2202:Hmgcs2 UTSW 3 98291183 missense probably damaging 1.00
R2203:Hmgcs2 UTSW 3 98291183 missense probably damaging 1.00
R2204:Hmgcs2 UTSW 3 98291183 missense probably damaging 1.00
R2205:Hmgcs2 UTSW 3 98291183 missense probably damaging 1.00
R3758:Hmgcs2 UTSW 3 98291090 missense probably damaging 1.00
R3779:Hmgcs2 UTSW 3 98299112 splice site probably benign
R3958:Hmgcs2 UTSW 3 98297477 missense possibly damaging 0.48
R3959:Hmgcs2 UTSW 3 98297477 missense possibly damaging 0.48
R3960:Hmgcs2 UTSW 3 98297477 missense possibly damaging 0.48
R4788:Hmgcs2 UTSW 3 98291084 missense probably damaging 1.00
R5102:Hmgcs2 UTSW 3 98280470 start gained probably benign
R5708:Hmgcs2 UTSW 3 98291162 missense probably damaging 1.00
R5742:Hmgcs2 UTSW 3 98297516 missense probably benign
R7268:Hmgcs2 UTSW 3 98297480 missense probably benign 0.02
R7294:Hmgcs2 UTSW 3 98290895 missense probably benign 0.09
R7503:Hmgcs2 UTSW 3 98302624 missense probably damaging 1.00
R7767:Hmgcs2 UTSW 3 98291266 missense probably damaging 1.00
R8043:Hmgcs2 UTSW 3 98291128 missense probably damaging 1.00
Z1176:Hmgcs2 UTSW 3 98290945 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCGGACAGACTACCATACAAAGAATG -3'
(R):5'- ACTGTTTTGACAGCCTTGGAC -3'

Sequencing Primer
(F):5'- CAATAATTGCCACATTATTGGTTGGG -3'
(R):5'- ACAGCCTTGGACTTGTCAATG -3'
Posted On2015-04-29