Incidental Mutation 'R3962:Fndc5'
ID312116
Institutional Source Beutler Lab
Gene Symbol Fndc5
Ensembl Gene ENSMUSG00000001334
Gene Namefibronectin type III domain containing 5
Synonyms1500001L03Rik, PeP, Pxp
MMRRC Submission 040837-MU
Accession Numbers

Genbank: NM_027402; MGI: 1917614  

Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R3962 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location129136999-129144593 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 129139895 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 152 (V152A)
Ref Sequence ENSEMBL: ENSMUSP00000099660 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102600]
Predicted Effect probably benign
Transcript: ENSMUST00000102600
AA Change: V152A

PolyPhen 2 Score 0.227 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000099660
Gene: ENSMUSG00000001334
AA Change: V152A

DomainStartEndE-ValueType
FN3 31 111 7.34e-9 SMART
Pfam:DUF4808 146 204 4.7e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124746
Meta Mutation Damage Score 0.0696 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 93.9%
Validation Efficiency 96% (48/50)
MGI Phenotype FUNCTION: This gene encodes a type I transmembrane protein containing fibronectin type III repeat. The encoded transmembrane protein undergoes proteolytic processing to generate a soluble hormone named irisin that is secreted into the bloodstream. The expression of this gene followed by the secretion of irisin from skeletal muscle is induced by exercise. The ectopic expression of the encoded protein in mice causes an elevation of irisin in blood and improves metabolic health. [provided by RefSeq, Jul 2016]
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik A G 19: 58,789,109 Y82H probably damaging Het
9930111J21Rik1 T C 11: 48,947,976 T595A possibly damaging Het
Abca12 A T 1: 71,274,515 probably null Het
Ablim2 C T 5: 35,812,175 R211C probably damaging Het
Actn4 C A 7: 28,898,222 probably null Het
AF529169 G A 9: 89,601,910 T478I probably damaging Het
B3gnt5 A G 16: 19,769,048 S6G probably benign Het
Bod1l T G 5: 41,808,721 E2667A probably benign Het
Ccdc13 G A 9: 121,798,939 probably benign Het
Ccdc15 G T 9: 37,320,486 R181S probably damaging Het
Ccnd1 G A 7: 144,934,050 T230M probably damaging Het
Cdcp1 T C 9: 123,182,381 T344A possibly damaging Het
Fam161a T C 11: 23,023,507 M275T possibly damaging Het
Fbxo15 A G 18: 84,959,247 T95A probably benign Het
Galk2 A T 2: 125,893,373 N107I probably benign Het
Glmn A T 5: 107,561,045 probably benign Het
Gm5082 T C 13: 41,656,418 noncoding transcript Het
Gm5828 C T 1: 16,768,644 noncoding transcript Het
Haus6 C T 4: 86,611,804 A4T possibly damaging Het
Hmgcs2 G A 3: 98,291,038 V86M possibly damaging Het
Hrg G A 16: 22,956,075 V152I possibly damaging Het
Itga2 A T 13: 114,839,518 V1106E probably damaging Het
Itga9 G A 9: 118,628,186 D122N possibly damaging Het
Kif21a T A 15: 90,985,409 E413V probably damaging Het
Klk1 A G 7: 44,229,549 T256A possibly damaging Het
L1td1 T C 4: 98,737,449 V627A probably benign Het
Larp4 C A 15: 100,012,145 Q652K probably damaging Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Moxd2 T A 6: 40,885,397 M163L probably benign Het
Myo15 G A 11: 60,479,828 R1138H probably benign Het
Oasl2 A G 5: 114,897,747 D28G probably benign Het
Olfr777 A T 10: 129,268,666 I219N probably damaging Het
Platr26 A T 2: 71,719,505 noncoding transcript Het
Ptdss1 A G 13: 66,994,011 H411R probably benign Het
Ptpa A G 2: 30,435,660 T147A probably damaging Het
Rfx2 T C 17: 56,785,302 Y307C probably damaging Het
Rtn3 T C 19: 7,458,145 S142G probably damaging Het
Shisa6 A G 11: 66,217,476 V525A probably damaging Het
Slc4a3 A G 1: 75,556,754 S1007G probably damaging Het
Srsf3 C T 17: 29,036,456 probably benign Het
Taar8a A G 10: 24,077,156 I219M probably damaging Het
Tars2 A G 3: 95,754,756 probably null Het
Tfap2d A G 1: 19,118,965 N245S probably damaging Het
Tlr6 T A 5: 64,954,985 H193L probably benign Het
Tomm20l T C 12: 71,117,578 V78A probably benign Het
Tsc2 G A 17: 24,621,166 probably benign Het
Usp2 A G 9: 44,075,657 D84G possibly damaging Het
V1ra8 A G 6: 90,203,484 N223S probably benign Het
Wnk2 C A 13: 49,070,977 R1122L probably damaging Het
Other mutations in Fndc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02656:Fndc5 APN 4 129139446 missense probably damaging 1.00
IGL03336:Fndc5 APN 4 129139918 missense probably benign 0.00
N/A - 287:Fndc5 UTSW 4 129139349 missense probably damaging 1.00
R0645:Fndc5 UTSW 4 129139837 splice site probably benign
R1202:Fndc5 UTSW 4 129139445 missense probably damaging 0.97
R4408:Fndc5 UTSW 4 129142529 splice site probably null
R5379:Fndc5 UTSW 4 129142094 missense probably damaging 1.00
R5539:Fndc5 UTSW 4 129138721 missense probably damaging 1.00
R6242:Fndc5 UTSW 4 129139895 missense probably benign 0.23
R6951:Fndc5 UTSW 4 129138780 missense possibly damaging 0.77
R7027:Fndc5 UTSW 4 129139523 missense probably benign 0.00
R7112:Fndc5 UTSW 4 129142122 missense probably benign 0.09
R8254:Fndc5 UTSW 4 129138721 missense possibly damaging 0.86
RF014:Fndc5 UTSW 4 129142167 missense probably benign 0.00
Z31818:Fndc5 UTSW 4 129139349 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCTGTCGCCCCAAAACAG -3'
(R):5'- CCACAGCATACAAGATGGTAGC -3'

Sequencing Primer
(F):5'- AACAGCCTTCACCCTGTTCCTG -3'
(R):5'- CATACAAGATGGTAGCAACATGC -3'
Posted On2015-04-29