Incidental Mutation 'R3962:Rfx2'
ID312152
Institutional Source Beutler Lab
Gene Symbol Rfx2
Ensembl Gene ENSMUSG00000024206
Gene Nameregulatory factor X, 2 (influences HLA class II expression)
Synonyms5430432H19Rik
MMRRC Submission 040837-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.728) question?
Stock #R3962 (G1)
Quality Score167
Status Validated
Chromosome17
Chromosomal Location56775897-56831008 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56785302 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 307 (Y307C)
Ref Sequence ENSEMBL: ENSMUSP00000084010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002444] [ENSMUST00000086801]
Predicted Effect probably damaging
Transcript: ENSMUST00000002444
AA Change: Y332C

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000002444
Gene: ENSMUSG00000024206
AA Change: Y332C

DomainStartEndE-ValueType
Pfam:RFX1_trans_act 4 149 1.9e-50 PFAM
Pfam:RFX_DNA_binding 192 269 4.3e-36 PFAM
Blast:HisKA 479 542 1e-31 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000086801
AA Change: Y307C

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000084010
Gene: ENSMUSG00000024206
AA Change: Y307C

DomainStartEndE-ValueType
Pfam:RFX1_trans_act 1 151 6.8e-56 PFAM
Pfam:RFX_DNA_binding 161 246 6e-41 PFAM
Blast:HisKA 454 517 1e-31 BLAST
Meta Mutation Damage Score 0.1657 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 93.9%
Validation Efficiency 96% (48/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the regulatory factor X gene family, which encodes transcription factors that contain a highly-conserved winged helix DNA binding domain. The protein encoded by this gene is structurally related to regulatory factors X1, X3, X4, and X5. It is a transcriptional activator that can bind DNA as a monomer or as a heterodimer with other RFX family members. This protein can bind to cis elements in the promoter of the IL-5 receptor alpha gene. Two transcript variants encoding different isoforms have been described for this gene, and both variants utilize alternative polyadenylation sites. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and lack an obvious embryonic phenotype but exhibit male infertility associated with a defect in spermatid maturation at or before the round and elongating spermatid stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik A G 19: 58,789,109 Y82H probably damaging Het
9930111J21Rik1 T C 11: 48,947,976 T595A possibly damaging Het
Abca12 A T 1: 71,274,515 probably null Het
Ablim2 C T 5: 35,812,175 R211C probably damaging Het
Actn4 C A 7: 28,898,222 probably null Het
AF529169 G A 9: 89,601,910 T478I probably damaging Het
B3gnt5 A G 16: 19,769,048 S6G probably benign Het
Bod1l T G 5: 41,808,721 E2667A probably benign Het
Ccdc13 G A 9: 121,798,939 probably benign Het
Ccdc15 G T 9: 37,320,486 R181S probably damaging Het
Ccnd1 G A 7: 144,934,050 T230M probably damaging Het
Cdcp1 T C 9: 123,182,381 T344A possibly damaging Het
Fam161a T C 11: 23,023,507 M275T possibly damaging Het
Fbxo15 A G 18: 84,959,247 T95A probably benign Het
Fndc5 T C 4: 129,139,895 V152A probably benign Het
Galk2 A T 2: 125,893,373 N107I probably benign Het
Glmn A T 5: 107,561,045 probably benign Het
Gm5082 T C 13: 41,656,418 noncoding transcript Het
Gm5828 C T 1: 16,768,644 noncoding transcript Het
Haus6 C T 4: 86,611,804 A4T possibly damaging Het
Hmgcs2 G A 3: 98,291,038 V86M possibly damaging Het
Hrg G A 16: 22,956,075 V152I possibly damaging Het
Itga2 A T 13: 114,839,518 V1106E probably damaging Het
Itga9 G A 9: 118,628,186 D122N possibly damaging Het
Kif21a T A 15: 90,985,409 E413V probably damaging Het
Klk1 A G 7: 44,229,549 T256A possibly damaging Het
L1td1 T C 4: 98,737,449 V627A probably benign Het
Larp4 C A 15: 100,012,145 Q652K probably damaging Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Moxd2 T A 6: 40,885,397 M163L probably benign Het
Myo15 G A 11: 60,479,828 R1138H probably benign Het
Oasl2 A G 5: 114,897,747 D28G probably benign Het
Olfr777 A T 10: 129,268,666 I219N probably damaging Het
Platr26 A T 2: 71,719,505 noncoding transcript Het
Ptdss1 A G 13: 66,994,011 H411R probably benign Het
Ptpa A G 2: 30,435,660 T147A probably damaging Het
Rtn3 T C 19: 7,458,145 S142G probably damaging Het
Shisa6 A G 11: 66,217,476 V525A probably damaging Het
Slc4a3 A G 1: 75,556,754 S1007G probably damaging Het
Srsf3 C T 17: 29,036,456 probably benign Het
Taar8a A G 10: 24,077,156 I219M probably damaging Het
Tars2 A G 3: 95,754,756 probably null Het
Tfap2d A G 1: 19,118,965 N245S probably damaging Het
Tlr6 T A 5: 64,954,985 H193L probably benign Het
Tomm20l T C 12: 71,117,578 V78A probably benign Het
Tsc2 G A 17: 24,621,166 probably benign Het
Usp2 A G 9: 44,075,657 D84G possibly damaging Het
V1ra8 A G 6: 90,203,484 N223S probably benign Het
Wnk2 C A 13: 49,070,977 R1122L probably damaging Het
Other mutations in Rfx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01294:Rfx2 APN 17 56783657 missense probably damaging 1.00
IGL01296:Rfx2 APN 17 56808317 start codon destroyed possibly damaging 0.81
IGL01488:Rfx2 APN 17 56805398 missense probably damaging 1.00
IGL01705:Rfx2 APN 17 56785303 missense possibly damaging 0.88
IGL02389:Rfx2 APN 17 56808325 splice site probably benign
IGL02601:Rfx2 APN 17 56785354 missense possibly damaging 0.75
IGL02609:Rfx2 APN 17 56805404 missense probably benign 0.00
R0066:Rfx2 UTSW 17 56786736 splice site probably benign
R0066:Rfx2 UTSW 17 56786736 splice site probably benign
R0197:Rfx2 UTSW 17 56803722 missense probably damaging 0.99
R0370:Rfx2 UTSW 17 56799308 missense probably benign 0.03
R0413:Rfx2 UTSW 17 56784418 splice site probably benign
R0622:Rfx2 UTSW 17 56777071 missense probably damaging 0.99
R0883:Rfx2 UTSW 17 56803722 missense probably damaging 0.99
R1429:Rfx2 UTSW 17 56804369 missense probably damaging 0.97
R1439:Rfx2 UTSW 17 56787720 missense probably damaging 1.00
R1569:Rfx2 UTSW 17 56804326 missense possibly damaging 0.63
R1654:Rfx2 UTSW 17 56808263 missense probably benign 0.00
R1751:Rfx2 UTSW 17 56784754 missense probably benign 0.01
R1816:Rfx2 UTSW 17 56808305 nonsense probably null
R2282:Rfx2 UTSW 17 56803722 missense probably damaging 0.99
R3408:Rfx2 UTSW 17 56803526 missense probably benign 0.00
R4415:Rfx2 UTSW 17 56787733 missense possibly damaging 0.95
R4876:Rfx2 UTSW 17 56784706 missense probably benign 0.00
R4883:Rfx2 UTSW 17 56783747 missense probably damaging 0.98
R5588:Rfx2 UTSW 17 56779890 missense possibly damaging 0.69
R5766:Rfx2 UTSW 17 56803587 missense probably benign 0.02
R5798:Rfx2 UTSW 17 56804362 missense possibly damaging 0.89
R5931:Rfx2 UTSW 17 56780778 missense probably damaging 0.99
R6061:Rfx2 UTSW 17 56777473 missense possibly damaging 0.86
R6466:Rfx2 UTSW 17 56784397 missense probably benign 0.13
R6800:Rfx2 UTSW 17 56780804 missense probably damaging 0.99
R7329:Rfx2 UTSW 17 56803681 missense probably benign 0.05
R7476:Rfx2 UTSW 17 56803527 missense probably benign 0.31
R8159:Rfx2 UTSW 17 56803605 missense probably benign 0.43
R8274:Rfx2 UTSW 17 56804348 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTATGCTCAGCTCTGGGTACAC -3'
(R):5'- TGAGTCCTCTGTGCTCACTG -3'

Sequencing Primer
(F):5'- TCTGGGTACACTGCCAGTAC -3'
(R):5'- GTGCTCACTGGGCTCATC -3'
Posted On2015-04-29