Incidental Mutation 'R3962:Fbxo15'
ID312153
Institutional Source Beutler Lab
Gene Symbol Fbxo15
Ensembl Gene ENSMUSG00000034391
Gene NameF-box protein 15
SynonymsFbx15, ecat3
MMRRC Submission 040837-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3962 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location84934782-84981472 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 84959247 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 95 (T95A)
Ref Sequence ENSEMBL: ENSMUSP00000152915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037718] [ENSMUST00000224467] [ENSMUST00000225445]
Predicted Effect probably benign
Transcript: ENSMUST00000037718
AA Change: T140A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000045925
Gene: ENSMUSG00000034391
AA Change: T140A

DomainStartEndE-ValueType
low complexity region 35 42 N/A INTRINSIC
FBOX 46 86 3.4e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223789
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224427
Predicted Effect probably benign
Transcript: ENSMUST00000224467
AA Change: T95A

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect probably benign
Transcript: ENSMUST00000225445
AA Change: T95A

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 93.9%
Validation Efficiency 96% (48/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the F-box protein family, such as FBXO15, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Both male and female homozygous null mice develop normally and are fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik A G 19: 58,789,109 Y82H probably damaging Het
9930111J21Rik1 T C 11: 48,947,976 T595A possibly damaging Het
Abca12 A T 1: 71,274,515 probably null Het
Ablim2 C T 5: 35,812,175 R211C probably damaging Het
Actn4 C A 7: 28,898,222 probably null Het
AF529169 G A 9: 89,601,910 T478I probably damaging Het
B3gnt5 A G 16: 19,769,048 S6G probably benign Het
Bod1l T G 5: 41,808,721 E2667A probably benign Het
Ccdc13 G A 9: 121,798,939 probably benign Het
Ccdc15 G T 9: 37,320,486 R181S probably damaging Het
Ccnd1 G A 7: 144,934,050 T230M probably damaging Het
Cdcp1 T C 9: 123,182,381 T344A possibly damaging Het
Fam161a T C 11: 23,023,507 M275T possibly damaging Het
Fndc5 T C 4: 129,139,895 V152A probably benign Het
Galk2 A T 2: 125,893,373 N107I probably benign Het
Glmn A T 5: 107,561,045 probably benign Het
Gm5082 T C 13: 41,656,418 noncoding transcript Het
Gm5828 C T 1: 16,768,644 noncoding transcript Het
Haus6 C T 4: 86,611,804 A4T possibly damaging Het
Hmgcs2 G A 3: 98,291,038 V86M possibly damaging Het
Hrg G A 16: 22,956,075 V152I possibly damaging Het
Itga2 A T 13: 114,839,518 V1106E probably damaging Het
Itga9 G A 9: 118,628,186 D122N possibly damaging Het
Kif21a T A 15: 90,985,409 E413V probably damaging Het
Klk1 A G 7: 44,229,549 T256A possibly damaging Het
L1td1 T C 4: 98,737,449 V627A probably benign Het
Larp4 C A 15: 100,012,145 Q652K probably damaging Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Moxd2 T A 6: 40,885,397 M163L probably benign Het
Myo15 G A 11: 60,479,828 R1138H probably benign Het
Oasl2 A G 5: 114,897,747 D28G probably benign Het
Olfr777 A T 10: 129,268,666 I219N probably damaging Het
Platr26 A T 2: 71,719,505 noncoding transcript Het
Ptdss1 A G 13: 66,994,011 H411R probably benign Het
Ptpa A G 2: 30,435,660 T147A probably damaging Het
Rfx2 T C 17: 56,785,302 Y307C probably damaging Het
Rtn3 T C 19: 7,458,145 S142G probably damaging Het
Shisa6 A G 11: 66,217,476 V525A probably damaging Het
Slc4a3 A G 1: 75,556,754 S1007G probably damaging Het
Srsf3 C T 17: 29,036,456 probably benign Het
Taar8a A G 10: 24,077,156 I219M probably damaging Het
Tars2 A G 3: 95,754,756 probably null Het
Tfap2d A G 1: 19,118,965 N245S probably damaging Het
Tlr6 T A 5: 64,954,985 H193L probably benign Het
Tomm20l T C 12: 71,117,578 V78A probably benign Het
Tsc2 G A 17: 24,621,166 probably benign Het
Usp2 A G 9: 44,075,657 D84G possibly damaging Het
V1ra8 A G 6: 90,203,484 N223S probably benign Het
Wnk2 C A 13: 49,070,977 R1122L probably damaging Het
Other mutations in Fbxo15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00517:Fbxo15 APN 18 84959100 missense probably damaging 1.00
IGL01375:Fbxo15 APN 18 84958279 missense possibly damaging 0.64
IGL01730:Fbxo15 APN 18 84964174 missense probably benign 0.38
IGL01807:Fbxo15 APN 18 84981381 utr 3 prime probably benign
IGL02220:Fbxo15 APN 18 84964192 critical splice donor site probably null
IGL02255:Fbxo15 APN 18 84964196 splice site probably null
IGL02435:Fbxo15 APN 18 84959226 missense probably damaging 0.97
IGL02546:Fbxo15 APN 18 84962722 critical splice donor site probably null
IGL03099:Fbxo15 APN 18 84981213 missense possibly damaging 0.87
R0346:Fbxo15 UTSW 18 84960221 critical splice donor site probably null
R1606:Fbxo15 UTSW 18 84962620 missense possibly damaging 0.93
R1671:Fbxo15 UTSW 18 84959106 missense possibly damaging 0.73
R2113:Fbxo15 UTSW 18 84959105 missense probably benign 0.00
R4064:Fbxo15 UTSW 18 84959118 missense probably damaging 0.96
R5523:Fbxo15 UTSW 18 84960069 missense probably damaging 1.00
R5931:Fbxo15 UTSW 18 84981125 missense probably damaging 0.96
R6235:Fbxo15 UTSW 18 84980904 intron probably benign
R6349:Fbxo15 UTSW 18 84964142 missense probably benign 0.01
R6607:Fbxo15 UTSW 18 84959145 missense possibly damaging 0.88
R7232:Fbxo15 UTSW 18 84962622 missense probably damaging 1.00
R7325:Fbxo15 UTSW 18 84959118 missense probably damaging 0.96
R7519:Fbxo15 UTSW 18 84964234 unclassified probably benign
R7671:Fbxo15 UTSW 18 84964153 missense probably damaging 1.00
R8094:Fbxo15 UTSW 18 84965493 missense probably benign 0.34
R8365:Fbxo15 UTSW 18 84962614 missense probably damaging 1.00
X0022:Fbxo15 UTSW 18 84960119 missense probably benign 0.00
Z1177:Fbxo15 UTSW 18 84958308 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTCTGATTAGGAAGGGTTTGAAC -3'
(R):5'- TCTCTGCATACACCTTGAGATG -3'

Sequencing Primer
(F):5'- GCTATAGCCTCCACACTGATGTG -3'
(R):5'- TGACAACATCTGGTTAGAGACTG -3'
Posted On2015-04-29