Mutagenetix > Incidental Mutation

Incidental Mutation 'R3963:Cr2'

312159

Institutional Source

Beutler Lab

Gene Symbol

Cr2

Ensembl Gene

ENSMUSG00000026616

Gene Name

complement receptor 2

Synonyms

C3DR, CD21, Cr-1, Cr1, CD35, Cr-2

MMRRC Submission

040932-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.118) question?

Stock #

R3963 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

195136811-195176716 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 195159739 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 302 (V302A)

Ref Sequence

ENSEMBL: ENSMUSP00000080938 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000082321] [ENSMUST00000193356] [ENSMUST00000193801] [ENSMUST00000195120] [ENSMUST00000210219]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000082321
AA Change: V302A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000080938
Gene: ENSMUSG00000026616
AA Change: V302A

Domain	Start	End	E-Value	Type
CCP	23	82	1.01e-11	SMART
CCP	91	147	9.1e-14	SMART
CCP	155	211	1.9e-16	SMART
CCP	216	272	1.6e-9	SMART
CCP	277	343	1.01e-11	SMART
CCP	352	407	1.2e-13	SMART
CCP	411	467	2.34e-16	SMART
CCP	472	523	1.24e0	SMART
CCP	528	594	4.48e-13	SMART
CCP	603	658	1.95e-13	SMART
CCP	718	778	1.75e-15	SMART
CCP	787	842	2.06e-12	SMART
CCP	850	906	7.92e-14	SMART
CCP	911	967	1.29e-13	SMART
transmembrane domain	975	997	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000193356
AA Change: V5A

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000141706
Gene: ENSMUSG00000026616
AA Change: V5A

Domain	Start	End	E-Value	Type
CCP	1	46	1.2e-1	SMART
CCP	55	110	5.9e-16	SMART
CCP	114	170	1.1e-18	SMART
CCP	175	226	6.1e-3	SMART
CCP	231	297	2.2e-15	SMART
CCP	306	361	9.4e-16	SMART
CCP	421	481	8.3e-18	SMART
CCP	490	545	1e-14	SMART
CCP	553	609	4e-16	SMART
CCP	614	670	6.2e-16	SMART
transmembrane domain	678	700	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000193801

SMART Domains

Protein: ENSMUSP00000141276
Gene: ENSMUSG00000026616

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194149

Predicted Effect

probably damaging
Transcript: ENSMUST00000195120
AA Change: V302A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000141538
Gene: ENSMUSG00000026616
AA Change: V302A

Domain	Start	End	E-Value	Type
CCP	23	82	4.9e-14	SMART
CCP	91	147	4.5e-16	SMART
CCP	155	211	9.1e-19	SMART
CCP	216	272	8e-12	SMART
CCP	277	343	5e-14	SMART
CCP	352	407	5.9e-16	SMART
CCP	411	467	1.1e-18	SMART
CCP	472	523	6.1e-3	SMART
CCP	528	594	2.2e-15	SMART
CCP	603	658	9.4e-16	SMART
CCP	718	778	8.3e-18	SMART
CCP	787	842	1e-14	SMART
CCP	850	906	4e-16	SMART
CCP	911	967	6.2e-16	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000210219
AA Change: V678A

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

Meta Mutation Damage Score

0.8907

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

100% (61/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein, which functions as a receptor for Epstein-Barr virus (EBV) binding on B and T lymphocytes. Genetic variations in this gene are associated with susceptibility to systemic lupus erythematosus type 9 (SLEB9). Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired humoral immune responses to T cell-dependent antigens, with limited affinity maturation, and reduced memory B cell and germinal center formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A830010M20Rik	G	A	5: 107,507,356	C1007Y	probably damaging	Het
Adamts18	T	C	8: 113,777,811	D59G	probably benign	Het
AF529169	G	A	9: 89,601,910	T478I	probably damaging	Het
Ank2	A	T	3: 126,934,596	S783T	probably benign	Het
Arfgef3	T	C	10: 18,592,277	D1725G	probably damaging	Het
B3gnt5	A	G	16: 19,769,048	S6G	probably benign	Het
Ccdc82	C	A	9: 13,252,386	T101K	possibly damaging	Het
Ccdc85a	A	C	11: 28,576,396	M376R	probably benign	Het
Cd200r1	T	A	16: 44,792,795	C255S	probably benign	Het
Cdc23	T	C	18: 34,646,919	M119V	probably benign	Het
Cers3	G	T	7: 66,786,075	A261S	probably benign	Het
Clptm1	C	T	7: 19,638,196	W238*	probably null	Het
Cyp4a31	A	G	4: 115,574,772		probably benign	Het
Dennd4a	T	A	9: 64,862,331	I440N	probably damaging	Het
Dsc2	C	T	18: 20,051,227	V35I	probably damaging	Het
Dyrk1a	T	A	16: 94,663,746	M71K	probably benign	Het
Exoc3l2	G	A	7: 19,495,256	G200S	probably benign	Het
Fam160b1	T	C	19: 57,373,010	L122P	possibly damaging	Het
Fkbp15	A	T	4: 62,340,677	I114N	probably damaging	Het
Fpr-rs6	G	A	17: 20,182,217	P294L	probably damaging	Het
Frmd6	A	G	12: 70,893,864	T428A	probably benign	Het
G6pd2	T	A	5: 61,808,885	M1K	probably null	Het
Gdf3	C	T	6: 122,606,758	V217I	probably benign	Het
Grm7	G	T	6: 110,646,348	V161F	probably damaging	Het
Gtf3c1	T	C	7: 125,693,225		probably null	Het
Hrg	G	A	16: 22,956,075	V152I	possibly damaging	Het
Itpkc	T	C	7: 27,227,509	T327A	probably damaging	Het
Jade1	T	C	3: 41,601,410	V304A	probably damaging	Het
Leo1	C	A	9: 75,450,480		probably benign	Het
Lrrc7	A	T	3: 158,160,405	L1233Q	probably damaging	Het
Ltbp3	G	A	19: 5,754,022	R854Q	probably benign	Het
Matn2	C	A	15: 34,388,791	Y342*	probably null	Het
Mlh3	T	C	12: 85,268,680	H244R	possibly damaging	Het
Mmaa	A	T	8: 79,268,214	V321E	probably damaging	Het
Ntng1	T	A	3: 109,934,868	L196F	probably damaging	Het
Oas1e	A	G	5: 120,794,140	V146A	probably damaging	Het
Olfr67	G	T	7: 103,788,034	T81K	probably benign	Het
Plcxd2	T	C	16: 45,980,501	K120R	probably damaging	Het
Prex2	G	T	1: 11,110,357	C382F	possibly damaging	Het
Psg29	T	A	7: 17,208,585	H170Q	probably benign	Het
Ptprk	A	G	10: 28,551,665	T747A	probably damaging	Het
Qk	G	A	17: 10,216,465		probably benign	Het
Rpusd2	A	G	2: 119,038,604	T503A	probably benign	Het
Rtn3	T	C	19: 7,458,145	S142G	probably damaging	Het
Slco1a5	C	T	6: 142,248,644		probably null	Het
Snap91	A	T	9: 86,775,612	W509R	probably damaging	Het
Srsf3	C	T	17: 29,036,456		probably benign	Het
Tmem267	A	T	13: 119,492,639		probably null	Het
Tmem63a	G	A	1: 180,963,114	D446N	possibly damaging	Het
Tnfaip8	C	A	18: 50,090,586	H154N	possibly damaging	Het
Trim35	T	C	14: 66,304,054	L209P	probably damaging	Het
Ttf1	A	G	2: 29,064,804	E60G	possibly damaging	Het
Ttf2	T	C	3: 100,941,820		probably benign	Het
Tubg2	T	C	11: 101,160,398		probably null	Het
Ubap1l	C	T	9: 65,369,195		probably benign	Het
Usp48	A	T	4: 137,633,439	R26*	probably null	Het
Vmn1r222	A	G	13: 23,232,932	V37A	probably benign	Het
Vmn2r4	T	A	3: 64,415,151	N49I	probably damaging	Het
Zfp979	A	T	4: 147,613,131	C374S	probably benign	Het

Other mutations in Cr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00587:Cr2	APN	1	195154251	missense	possibly damaging	0.76
IGL01326:Cr2	APN	1	195141221	missense	probably null	1.00
IGL01358:Cr2	APN	1	195159820	missense	probably damaging	1.00
IGL01410:Cr2	APN	1	195163234	missense	possibly damaging	0.49
IGL01468:Cr2	APN	1	195168535	missense	probably damaging	1.00
IGL01608:Cr2	APN	1	195155220	missense	possibly damaging	0.50
IGL01810:Cr2	APN	1	195159595	missense	possibly damaging	0.49
IGL01843:Cr2	APN	1	195150914	splice site	probably benign
IGL02332:Cr2	APN	1	195160322	missense	probably benign	0.19
IGL02934:Cr2	APN	1	195154325	splice site	probably benign
IGL02938:Cr2	APN	1	195166388	missense	probably damaging	1.00
IGL03149:Cr2	APN	1	195166366	missense	probably damaging	1.00
IGL03327:Cr2	APN	1	195169759	missense	probably damaging	1.00
IGL03346:Cr2	APN	1	195169759	missense	probably damaging	1.00
Pillar	UTSW	1	195155888	nonsense	probably null
PIT4354001:Cr2	UTSW	1	195166309	missense	probably damaging	1.00
PIT4418001:Cr2	UTSW	1	195157452	missense	probably benign	0.08
R0128:Cr2	UTSW	1	195166231	missense	probably damaging	0.99
R0130:Cr2	UTSW	1	195166231	missense	probably damaging	0.99
R0380:Cr2	UTSW	1	195157407	missense	probably damaging	1.00
R0538:Cr2	UTSW	1	195160359	splice site	probably benign
R0605:Cr2	UTSW	1	195163596	splice site	probably benign
R0626:Cr2	UTSW	1	195171111	missense	possibly damaging	0.95
R1135:Cr2	UTSW	1	195157190	missense	probably damaging	1.00
R1396:Cr2	UTSW	1	195169253	splice site	probably null
R1422:Cr2	UTSW	1	195171125	missense	probably benign	0.01
R1467:Cr2	UTSW	1	195157509	missense	probably damaging	1.00
R1467:Cr2	UTSW	1	195157509	missense	probably damaging	1.00
R1511:Cr2	UTSW	1	195155272	missense	possibly damaging	0.92
R1572:Cr2	UTSW	1	195163314	missense	probably damaging	1.00
R1714:Cr2	UTSW	1	195151686	missense	possibly damaging	0.46
R1748:Cr2	UTSW	1	195155905	nonsense	probably null
R1761:Cr2	UTSW	1	195155123	critical splice donor site	probably null
R1824:Cr2	UTSW	1	195157316	missense	probably damaging	1.00
R1893:Cr2	UTSW	1	195155187	missense	probably benign	0.03
R1990:Cr2	UTSW	1	195154150	missense	possibly damaging	0.63
R1991:Cr2	UTSW	1	195154150	missense	possibly damaging	0.63
R1992:Cr2	UTSW	1	195154150	missense	possibly damaging	0.63
R2191:Cr2	UTSW	1	195163381	missense	possibly damaging	0.94
R2276:Cr2	UTSW	1	195157368	missense	possibly damaging	0.94
R2277:Cr2	UTSW	1	195157368	missense	possibly damaging	0.94
R3548:Cr2	UTSW	1	195155888	nonsense	probably null
R3743:Cr2	UTSW	1	195149966	splice site	probably benign
R3941:Cr2	UTSW	1	195165814	missense	probably damaging	0.97
R4211:Cr2	UTSW	1	195156328	missense	probably damaging	0.96
R4484:Cr2	UTSW	1	195154174	missense	probably damaging	1.00
R4546:Cr2	UTSW	1	195171041	missense	possibly damaging	0.94
R4791:Cr2	UTSW	1	195155935	missense	probably damaging	1.00
R4801:Cr2	UTSW	1	195163311	missense	probably damaging	1.00
R4802:Cr2	UTSW	1	195163311	missense	probably damaging	1.00
R4874:Cr2	UTSW	1	195176570	missense	possibly damaging	0.82
R4885:Cr2	UTSW	1	195158731	missense	possibly damaging	0.92
R4889:Cr2	UTSW	1	195176585	missense	possibly damaging	0.70
R5154:Cr2	UTSW	1	195159446	missense	probably damaging	1.00
R5574:Cr2	UTSW	1	195141236	missense	probably damaging	1.00
R5594:Cr2	UTSW	1	195157190	missense	probably damaging	1.00
R5645:Cr2	UTSW	1	195154273	missense	probably damaging	1.00
R5700:Cr2	UTSW	1	195159757	missense	probably damaging	0.96
R5929:Cr2	UTSW	1	195171111	missense	possibly damaging	0.91
R6237:Cr2	UTSW	1	195157502	missense	probably damaging	1.00
R6299:Cr2	UTSW	1	195168646	missense	probably damaging	1.00
R6368:Cr2	UTSW	1	195168472	missense	probably damaging	1.00
R6406:Cr2	UTSW	1	195169771	missense	probably damaging	1.00
R6618:Cr2	UTSW	1	195157379	missense	probably damaging	0.98
R6684:Cr2	UTSW	1	195171021	nonsense	probably null
R6720:Cr2	UTSW	1	195155200	missense	probably damaging	0.97
R6866:Cr2	UTSW	1	195151691	missense	probably damaging	1.00
R6915:Cr2	UTSW	1	195171146	missense	probably benign	0.06
R7057:Cr2	UTSW	1	195151610	missense	possibly damaging	0.83
R7117:Cr2	UTSW	1	195160601	missense	possibly damaging	0.79
R7200:Cr2	UTSW	1	195163249	missense	probably damaging	1.00
R7209:Cr2	UTSW	1	195168724	missense	probably damaging	1.00
R7350:Cr2	UTSW	1	195155286	missense	probably benign	0.21
R7414:Cr2	UTSW	1	195150036	missense	probably benign
R7453:Cr2	UTSW	1	195165257	splice site	probably null
R7479:Cr2	UTSW	1	195158410	critical splice donor site	probably null
R7480:Cr2	UTSW	1	195154176	missense	probably damaging	1.00
R7570:Cr2	UTSW	1	195169340	nonsense	probably null
R7666:Cr2	UTSW	1	195154225	missense	probably damaging	1.00
R7921:Cr2	UTSW	1	195151667	missense	possibly damaging	0.94
R7923:Cr2	UTSW	1	195168687	missense	probably benign	0.03
R8396:Cr2	UTSW	1	195158068	missense	probably damaging	1.00
R8503:Cr2	UTSW	1	195163542	missense	probably benign
R8517:Cr2	UTSW	1	195155899	missense	probably benign	0.03
R8773:Cr2	UTSW	1	195158605	missense	probably damaging	1.00
R8849:Cr2	UTSW	1	195157239	missense	probably damaging	1.00
R8896:Cr2	UTSW	1	195169273	missense	possibly damaging	0.58
R8938:Cr2	UTSW	1	195171116	missense	probably damaging	0.99
R9027:Cr2	UTSW	1	195151721	missense	probably benign	0.08
R9045:Cr2	UTSW	1	195155372	missense	possibly damaging	0.61
R9116:Cr2	UTSW	1	195158669	nonsense	probably null
R9137:Cr2	UTSW	1	195168332	critical splice donor site	probably null
R9476:Cr2	UTSW	1	195158108	missense	probably damaging	0.97
R9497:Cr2	UTSW	1	195168435	missense	probably damaging	0.99
R9510:Cr2	UTSW	1	195158108	missense	probably damaging	0.97
R9752:Cr2	UTSW	1	195141267	missense	probably benign	0.37
R9799:Cr2	UTSW	1	195160680	missense	probably benign	0.02
X0028:Cr2	UTSW	1	195149982	missense	probably benign	0.09
X0066:Cr2	UTSW	1	195166321	missense	probably damaging	0.99
Z1176:Cr2	UTSW	1	195154153	missense	probably benign	0.23

Predicted Primers

PCR Primer
(F):5'- TCCTGTTGCCCTTCAAGGTG -3'
(R):5'- GGGAACTTGACCCAATGTGTATAAAG -3'

Sequencing Primer
(F):5'- CTTCAAGGTGAAGCCAGGTTCAC -3'
(R):5'- ACCCAATGTGTATAAAGAAGATTGTG -3'

Posted On

2015-04-29