Incidental Mutation 'R3963:Usp48'
ID 312171
Institutional Source Beutler Lab
Gene Symbol Usp48
Ensembl Gene ENSMUSG00000043411
Gene Name ubiquitin specific peptidase 48
Synonyms Usp31, D330022K21Rik, 2810449C13Rik
MMRRC Submission 040932-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock # R3963 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 137593755-137658537 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 137633439 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 26 (R26*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055131] [ENSMUST00000105840] [ENSMUST00000141628]
AlphaFold Q3V0C5
Predicted Effect probably null
Transcript: ENSMUST00000055131
AA Change: R728*
SMART Domains Protein: ENSMUSP00000055016
Gene: ENSMUSG00000043411
AA Change: R728*

DomainStartEndE-ValueType
Pfam:UCH 88 417 6.9e-44 PFAM
Pfam:UCH_1 89 374 1e-22 PFAM
Blast:DUSP 479 555 5e-39 BLAST
coiled coil region 622 643 N/A INTRINSIC
UBQ 954 1022 4.78e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000105840
AA Change: R730*
SMART Domains Protein: ENSMUSP00000101466
Gene: ENSMUSG00000043411
AA Change: R730*

DomainStartEndE-ValueType
Pfam:UCH 88 418 6.4e-49 PFAM
Pfam:UCH_1 89 374 1.8e-27 PFAM
Blast:DUSP 480 556 4e-39 BLAST
coiled coil region 624 645 N/A INTRINSIC
Blast:DUSP 743 824 2e-7 BLAST
UBQ 938 1006 4.78e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000128065
AA Change: R147*
SMART Domains Protein: ENSMUSP00000115533
Gene: ENSMUSG00000043411
AA Change: R147*

DomainStartEndE-ValueType
Blast:DUSP 9 111 2e-13 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000131755
AA Change: R2*
Predicted Effect probably null
Transcript: ENSMUST00000141426
AA Change: R26*
SMART Domains Protein: ENSMUSP00000118084
Gene: ENSMUSG00000043411
AA Change: R26*

DomainStartEndE-ValueType
UBQ 63 131 4.78e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000141628
SMART Domains Protein: ENSMUSP00000119691
Gene: ENSMUSG00000043411

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
UBQ 185 253 4.78e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152985
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154395
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing domains that associate it with the peptidase family C19, also known as family 2 of ubiquitin carboxyl-terminal hydrolases. Family members function as deubiquitinating enzymes, recognizing and hydrolyzing the peptide bond at the C-terminal glycine of ubiquitin. Enzymes in peptidase family C19 are involved in the processing of poly-ubiquitin precursors as well as that of ubiquitinated proteins. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830010M20Rik G A 5: 107,507,356 C1007Y probably damaging Het
Adamts18 T C 8: 113,777,811 D59G probably benign Het
AF529169 G A 9: 89,601,910 T478I probably damaging Het
Ank2 A T 3: 126,934,596 S783T probably benign Het
Arfgef3 T C 10: 18,592,277 D1725G probably damaging Het
B3gnt5 A G 16: 19,769,048 S6G probably benign Het
Ccdc82 C A 9: 13,252,386 T101K possibly damaging Het
Ccdc85a A C 11: 28,576,396 M376R probably benign Het
Cd200r1 T A 16: 44,792,795 C255S probably benign Het
Cdc23 T C 18: 34,646,919 M119V probably benign Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Clptm1 C T 7: 19,638,196 W238* probably null Het
Cr2 A G 1: 195,159,739 V302A probably damaging Het
Cyp4a31 A G 4: 115,574,772 probably benign Het
Dennd4a T A 9: 64,862,331 I440N probably damaging Het
Dsc2 C T 18: 20,051,227 V35I probably damaging Het
Dyrk1a T A 16: 94,663,746 M71K probably benign Het
Exoc3l2 G A 7: 19,495,256 G200S probably benign Het
Fam160b1 T C 19: 57,373,010 L122P possibly damaging Het
Fkbp15 A T 4: 62,340,677 I114N probably damaging Het
Fpr-rs6 G A 17: 20,182,217 P294L probably damaging Het
Frmd6 A G 12: 70,893,864 T428A probably benign Het
G6pd2 T A 5: 61,808,885 M1K probably null Het
Gdf3 C T 6: 122,606,758 V217I probably benign Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Gtf3c1 T C 7: 125,693,225 probably null Het
Hrg G A 16: 22,956,075 V152I possibly damaging Het
Itpkc T C 7: 27,227,509 T327A probably damaging Het
Jade1 T C 3: 41,601,410 V304A probably damaging Het
Leo1 C A 9: 75,450,480 probably benign Het
Lrrc7 A T 3: 158,160,405 L1233Q probably damaging Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Matn2 C A 15: 34,388,791 Y342* probably null Het
Mlh3 T C 12: 85,268,680 H244R possibly damaging Het
Mmaa A T 8: 79,268,214 V321E probably damaging Het
Ntng1 T A 3: 109,934,868 L196F probably damaging Het
Oas1e A G 5: 120,794,140 V146A probably damaging Het
Olfr67 G T 7: 103,788,034 T81K probably benign Het
Plcxd2 T C 16: 45,980,501 K120R probably damaging Het
Prex2 G T 1: 11,110,357 C382F possibly damaging Het
Psg29 T A 7: 17,208,585 H170Q probably benign Het
Ptprk A G 10: 28,551,665 T747A probably damaging Het
Qk G A 17: 10,216,465 probably benign Het
Rpusd2 A G 2: 119,038,604 T503A probably benign Het
Rtn3 T C 19: 7,458,145 S142G probably damaging Het
Slco1a5 C T 6: 142,248,644 probably null Het
Snap91 A T 9: 86,775,612 W509R probably damaging Het
Srsf3 C T 17: 29,036,456 probably benign Het
Tmem267 A T 13: 119,492,639 probably null Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Tnfaip8 C A 18: 50,090,586 H154N possibly damaging Het
Trim35 T C 14: 66,304,054 L209P probably damaging Het
Ttf1 A G 2: 29,064,804 E60G possibly damaging Het
Ttf2 T C 3: 100,941,820 probably benign Het
Tubg2 T C 11: 101,160,398 probably null Het
Ubap1l C T 9: 65,369,195 probably benign Het
Vmn1r222 A G 13: 23,232,932 V37A probably benign Het
Vmn2r4 T A 3: 64,415,151 N49I probably damaging Het
Zfp979 A T 4: 147,613,131 C374S probably benign Het
Other mutations in Usp48
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01691:Usp48 APN 4 137623272 critical splice acceptor site probably null
IGL01864:Usp48 APN 4 137639227 missense possibly damaging 0.87
IGL02386:Usp48 APN 4 137604523 missense possibly damaging 0.93
IGL03112:Usp48 APN 4 137608064 missense probably damaging 1.00
IGL03114:Usp48 APN 4 137656125 missense probably damaging 1.00
IGL03406:Usp48 APN 4 137639295 missense possibly damaging 0.90
balfour UTSW 4 137633455 missense probably benign 0.00
burlap UTSW 4 137625276 missense possibly damaging 0.77
fulfillment UTSW 4 137638233 missense probably damaging 1.00
hayao UTSW 4 137633439 nonsense probably null
Mei UTSW 4 137606693 nonsense probably null
miyazaki UTSW 4 137608154 missense probably damaging 1.00
promise UTSW 4 137634921 missense probably damaging 1.00
satsuki UTSW 4 137633126 missense possibly damaging 0.93
Totoro UTSW 4 137594483 missense probably damaging 0.99
IGL02796:Usp48 UTSW 4 137610718 missense probably damaging 1.00
R0050:Usp48 UTSW 4 137613803 missense probably damaging 1.00
R0333:Usp48 UTSW 4 137594483 missense probably damaging 0.99
R0382:Usp48 UTSW 4 137621218 missense probably benign 0.00
R0423:Usp48 UTSW 4 137616411 missense probably benign
R0570:Usp48 UTSW 4 137633126 missense possibly damaging 0.93
R0855:Usp48 UTSW 4 137608154 missense probably damaging 1.00
R0943:Usp48 UTSW 4 137644470 missense possibly damaging 0.92
R1367:Usp48 UTSW 4 137639295 missense possibly damaging 0.90
R1367:Usp48 UTSW 4 137644463 missense probably damaging 1.00
R1689:Usp48 UTSW 4 137656107 splice site probably null
R1725:Usp48 UTSW 4 137633422 nonsense probably null
R2520:Usp48 UTSW 4 137625251 missense probably benign 0.05
R2965:Usp48 UTSW 4 137613762 missense probably damaging 1.00
R2966:Usp48 UTSW 4 137613762 missense probably damaging 1.00
R3026:Usp48 UTSW 4 137594444 missense probably benign 0.06
R4087:Usp48 UTSW 4 137623340 missense possibly damaging 0.95
R4633:Usp48 UTSW 4 137634900 missense probably damaging 0.96
R4677:Usp48 UTSW 4 137616381 missense probably benign 0.16
R4735:Usp48 UTSW 4 137633369 nonsense probably null
R4932:Usp48 UTSW 4 137615833 missense probably benign 0.00
R4932:Usp48 UTSW 4 137615834 splice site probably null
R4935:Usp48 UTSW 4 137650358 missense probably benign 0.42
R4952:Usp48 UTSW 4 137606693 nonsense probably null
R5034:Usp48 UTSW 4 137606757 nonsense probably null
R5153:Usp48 UTSW 4 137616362 missense possibly damaging 0.68
R5443:Usp48 UTSW 4 137621221 missense possibly damaging 0.78
R5591:Usp48 UTSW 4 137652652 intron probably benign
R5825:Usp48 UTSW 4 137623378 missense probably benign
R5889:Usp48 UTSW 4 137616412 missense probably benign
R5955:Usp48 UTSW 4 137615818 missense probably benign
R6089:Usp48 UTSW 4 137605818 missense probably damaging 1.00
R6443:Usp48 UTSW 4 137613763 missense probably damaging 1.00
R6473:Usp48 UTSW 4 137609108 critical splice donor site probably null
R6482:Usp48 UTSW 4 137634921 missense probably damaging 1.00
R6859:Usp48 UTSW 4 137625276 missense possibly damaging 0.77
R6916:Usp48 UTSW 4 137638233 missense probably damaging 1.00
R6977:Usp48 UTSW 4 137650360 missense probably damaging 1.00
R7749:Usp48 UTSW 4 137650417 missense probably damaging 1.00
R7759:Usp48 UTSW 4 137594452 missense probably benign 0.25
R7767:Usp48 UTSW 4 137604645 critical splice donor site probably null
R7850:Usp48 UTSW 4 137605749 splice site probably null
R7881:Usp48 UTSW 4 137633455 missense probably benign 0.00
R7897:Usp48 UTSW 4 137644428 missense probably damaging 0.96
R8186:Usp48 UTSW 4 137621196 missense possibly damaging 0.83
R8198:Usp48 UTSW 4 137621159 unclassified probably benign
R8353:Usp48 UTSW 4 137623382 missense probably benign 0.00
R8466:Usp48 UTSW 4 137623319 missense probably null 1.00
R8506:Usp48 UTSW 4 137610718 missense probably damaging 1.00
R8821:Usp48 UTSW 4 137613769 missense probably damaging 1.00
R8831:Usp48 UTSW 4 137613769 missense probably damaging 1.00
R8911:Usp48 UTSW 4 137613685 missense probably benign 0.00
R9043:Usp48 UTSW 4 137613685 missense probably benign 0.00
R9044:Usp48 UTSW 4 137613685 missense probably benign 0.00
R9289:Usp48 UTSW 4 137613685 missense probably benign 0.00
R9295:Usp48 UTSW 4 137613685 missense probably benign 0.00
R9296:Usp48 UTSW 4 137613685 missense probably benign 0.00
R9297:Usp48 UTSW 4 137613685 missense probably benign 0.00
R9317:Usp48 UTSW 4 137613685 missense probably benign 0.00
R9460:Usp48 UTSW 4 137613685 missense probably benign 0.00
R9480:Usp48 UTSW 4 137613685 missense probably benign 0.00
R9481:Usp48 UTSW 4 137613685 missense probably benign 0.00
R9520:Usp48 UTSW 4 137613685 missense probably benign 0.00
R9521:Usp48 UTSW 4 137613685 missense probably benign 0.00
R9522:Usp48 UTSW 4 137613685 missense probably benign 0.00
R9627:Usp48 UTSW 4 137613685 missense probably benign 0.00
R9698:Usp48 UTSW 4 137633891 missense possibly damaging 0.94
R9752:Usp48 UTSW 4 137613826 missense probably damaging 1.00
R9784:Usp48 UTSW 4 137594501 missense probably benign 0.06
RF002:Usp48 UTSW 4 137605795 missense probably damaging 1.00
Z1176:Usp48 UTSW 4 137604637 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AAGTTACAGAGAGTGCTGCTC -3'
(R):5'- ACCCCTTGTTATATTCAGGTTGTG -3'

Sequencing Primer
(F):5'- CGTAGCTCTAATGTCTGAGGGAAG -3'
(R):5'- TCAGGTTGTGCAATAAAATGGAAC -3'
Genotyping

Genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transversion.
 

PCR Primers

R39630014_PCR_F: 5’- AAGTTACAGAGAGTGCTGCTC-3’

R39630014_PCR_R: 5’- ACCCCTTGTTATATTCAGGTTGTG-3’

 

Sequencing Primers

R39630014_SEQ_F: 5’- CGTAGCTCTAATGTCTGAGGGAAG-3’
 

R39630014_SEQ_R: 5’- TCAGGTTGTGCAATAAAATGGAAC-3’
 

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               hold

 

The following sequence of 409 nucleotides is amplified (NCBI RefSeq: NC_000070, chromosome 4:137633208-137633616):

  

aagttacaga gagtgctgct cgcagtgcaa ggtgcgtagc tctaatgtct gagggaagga       

aaggtttgcc cctccctggg gtgggggggt gcctgtgacc agtgcgggtc ggctgacggc      

ttccatcttt ttcagatact agaacgagaa ggtgaagaaa acgaagcctt gcataagatg      

atagcaaacg agcagaagac ctcacttcca aacttgttcc aggacaaaaa cagaccatgt      

ctcagtaact ggccagaggt actgattgcc cgcagcttta aaggcctctg cagatttttg      

tgaggtcaac ctggccttct tctccttctt cctcacttcc ttctctcatc gggaggcaca      

ccagctcact agttccattt tattgcacaa cctgaatata acaaggggt

 

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text (Chr. + strand, A>T).
Posted On 2015-04-29