Mutagenetix > Incidental Mutation

Incidental Mutation 'R3963:Slco1a5'

312178

Institutional Source

Beutler Lab

Gene Symbol

Slco1a5

Ensembl Gene

ENSMUSG00000063975

Gene Name

solute carrier organic anion transporter family, member 1a5

Synonyms

Oatp3, Slc21a7

MMRRC Submission

040932-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.068) question?

Stock #

R3963 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

142234227-142322981 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

C to T at 142248644 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000137607 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081380] [ENSMUST00000111825] [ENSMUST00000153268]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000081380

SMART Domains

Protein: ENSMUSP00000080116
Gene: ENSMUSG00000063975

Domain	Start	End	E-Value	Type
Pfam:MFS_1	22	420	4.3e-30	PFAM
KAZAL	438	486	2.18e0	SMART
transmembrane domain	600	622	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000111822

Predicted Effect

probably null
Transcript: ENSMUST00000111825

SMART Domains

Protein: ENSMUSP00000137607
Gene: ENSMUSG00000063975

Domain	Start	End	E-Value	Type
Pfam:MFS_1	22	420	5.8e-30	PFAM
KAZAL	438	486	2.18e0	SMART
transmembrane domain	600	622	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000153268

SMART Domains

Protein: ENSMUSP00000124829
Gene: ENSMUSG00000063975

Domain	Start	End	E-Value	Type
Pfam:OATP	19	74	3.4e-16	PFAM

Meta Mutation Damage Score

0.9493

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

100% (61/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sodium-independent transporter which mediates cellular uptake of organic ions in the liver. Its substrates include bile acids, bromosulphophthalein, and some steroidal compounds. The protein is a member of the SLC21A family of solute carriers. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Dec 2008]
PHENOTYPE: Homozygous mutation of this gene results in decreased percentage of CD8 ells and increased percentage of B cells in the peripheral blood. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A830010M20Rik	G	A	5: 107,507,356	C1007Y	probably damaging	Het
Adamts18	T	C	8: 113,777,811	D59G	probably benign	Het
AF529169	G	A	9: 89,601,910	T478I	probably damaging	Het
Ank2	A	T	3: 126,934,596	S783T	probably benign	Het
Arfgef3	T	C	10: 18,592,277	D1725G	probably damaging	Het
B3gnt5	A	G	16: 19,769,048	S6G	probably benign	Het
Ccdc82	C	A	9: 13,252,386	T101K	possibly damaging	Het
Ccdc85a	A	C	11: 28,576,396	M376R	probably benign	Het
Cd200r1	T	A	16: 44,792,795	C255S	probably benign	Het
Cdc23	T	C	18: 34,646,919	M119V	probably benign	Het
Cers3	G	T	7: 66,786,075	A261S	probably benign	Het
Clptm1	C	T	7: 19,638,196	W238*	probably null	Het
Cr2	A	G	1: 195,159,739	V302A	probably damaging	Het
Cyp4a31	A	G	4: 115,574,772		probably benign	Het
Dennd4a	T	A	9: 64,862,331	I440N	probably damaging	Het
Dsc2	C	T	18: 20,051,227	V35I	probably damaging	Het
Dyrk1a	T	A	16: 94,663,746	M71K	probably benign	Het
Exoc3l2	G	A	7: 19,495,256	G200S	probably benign	Het
Fam160b1	T	C	19: 57,373,010	L122P	possibly damaging	Het
Fkbp15	A	T	4: 62,340,677	I114N	probably damaging	Het
Fpr-rs6	G	A	17: 20,182,217	P294L	probably damaging	Het
Frmd6	A	G	12: 70,893,864	T428A	probably benign	Het
G6pd2	T	A	5: 61,808,885	M1K	probably null	Het
Gdf3	C	T	6: 122,606,758	V217I	probably benign	Het
Grm7	G	T	6: 110,646,348	V161F	probably damaging	Het
Gtf3c1	T	C	7: 125,693,225		probably null	Het
Hrg	G	A	16: 22,956,075	V152I	possibly damaging	Het
Itpkc	T	C	7: 27,227,509	T327A	probably damaging	Het
Jade1	T	C	3: 41,601,410	V304A	probably damaging	Het
Leo1	C	A	9: 75,450,480		probably benign	Het
Lrrc7	A	T	3: 158,160,405	L1233Q	probably damaging	Het
Ltbp3	G	A	19: 5,754,022	R854Q	probably benign	Het
Matn2	C	A	15: 34,388,791	Y342*	probably null	Het
Mlh3	T	C	12: 85,268,680	H244R	possibly damaging	Het
Mmaa	A	T	8: 79,268,214	V321E	probably damaging	Het
Ntng1	T	A	3: 109,934,868	L196F	probably damaging	Het
Oas1e	A	G	5: 120,794,140	V146A	probably damaging	Het
Olfr67	G	T	7: 103,788,034	T81K	probably benign	Het
Plcxd2	T	C	16: 45,980,501	K120R	probably damaging	Het
Prex2	G	T	1: 11,110,357	C382F	possibly damaging	Het
Psg29	T	A	7: 17,208,585	H170Q	probably benign	Het
Ptprk	A	G	10: 28,551,665	T747A	probably damaging	Het
Qk	G	A	17: 10,216,465		probably benign	Het
Rpusd2	A	G	2: 119,038,604	T503A	probably benign	Het
Rtn3	T	C	19: 7,458,145	S142G	probably damaging	Het
Snap91	A	T	9: 86,775,612	W509R	probably damaging	Het
Srsf3	C	T	17: 29,036,456		probably benign	Het
Tmem267	A	T	13: 119,492,639		probably null	Het
Tmem63a	G	A	1: 180,963,114	D446N	possibly damaging	Het
Tnfaip8	C	A	18: 50,090,586	H154N	possibly damaging	Het
Trim35	T	C	14: 66,304,054	L209P	probably damaging	Het
Ttf1	A	G	2: 29,064,804	E60G	possibly damaging	Het
Ttf2	T	C	3: 100,941,820		probably benign	Het
Tubg2	T	C	11: 101,160,398		probably null	Het
Ubap1l	C	T	9: 65,369,195		probably benign	Het
Usp48	A	T	4: 137,633,439	R26*	probably null	Het
Vmn1r222	A	G	13: 23,232,932	V37A	probably benign	Het
Vmn2r4	T	A	3: 64,415,151	N49I	probably damaging	Het
Zfp979	A	T	4: 147,613,131	C374S	probably benign	Het

Other mutations in Slco1a5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01304:Slco1a5	APN	6	142242150	missense	probably benign	0.00
IGL01432:Slco1a5	APN	6	142236286	missense	possibly damaging	0.59
IGL01590:Slco1a5	APN	6	142250319	missense	probably benign	0.01
IGL01824:Slco1a5	APN	6	142253037	missense	probably benign	0.01
IGL01915:Slco1a5	APN	6	142243873	missense	probably benign	0.00
IGL01945:Slco1a5	APN	6	142243989	critical splice acceptor site	probably null
IGL02078:Slco1a5	APN	6	142254446	missense	probably benign	0.30
IGL02178:Slco1a5	APN	6	142262688	nonsense	probably null
IGL02366:Slco1a5	APN	6	142250215	missense	possibly damaging	0.57
IGL02395:Slco1a5	APN	6	142275487	missense	probably damaging	0.99
IGL02621:Slco1a5	APN	6	142242015	missense	probably benign	0.10
IGL02752:Slco1a5	APN	6	142262712	missense	probably benign	0.07
IGL02940:Slco1a5	APN	6	142242005	missense	probably damaging	1.00
IGL03065:Slco1a5	APN	6	142248843	splice site	probably benign
IGL03377:Slco1a5	APN	6	142234766	missense	probably benign	0.01
R0017:Slco1a5	UTSW	6	142236335	splice site	probably benign
R0017:Slco1a5	UTSW	6	142236335	splice site	probably benign
R0230:Slco1a5	UTSW	6	142236328	splice site	probably benign
R0690:Slco1a5	UTSW	6	142268278	missense	probably benign	0.24
R1217:Slco1a5	UTSW	6	142254374	missense	probably damaging	0.98
R1900:Slco1a5	UTSW	6	142242063	missense	probably benign	0.44
R2084:Slco1a5	UTSW	6	142234711	missense	probably benign	0.32
R2393:Slco1a5	UTSW	6	142248775	missense	possibly damaging	0.85
R2414:Slco1a5	UTSW	6	142236250	missense	probably damaging	1.00
R2760:Slco1a5	UTSW	6	142250271	missense	probably benign	0.00
R3420:Slco1a5	UTSW	6	142268238	missense	possibly damaging	0.61
R3421:Slco1a5	UTSW	6	142268238	missense	possibly damaging	0.61
R3827:Slco1a5	UTSW	6	142253249	missense	probably damaging	0.97
R3977:Slco1a5	UTSW	6	142258972	splice site	probably benign
R4074:Slco1a5	UTSW	6	142268224	missense	possibly damaging	0.88
R4075:Slco1a5	UTSW	6	142268224	missense	possibly damaging	0.88
R4076:Slco1a5	UTSW	6	142268224	missense	possibly damaging	0.88
R4782:Slco1a5	UTSW	6	142248807	missense	possibly damaging	0.82
R4799:Slco1a5	UTSW	6	142248807	missense	possibly damaging	0.82
R4831:Slco1a5	UTSW	6	142234705	missense	probably benign
R5038:Slco1a5	UTSW	6	142262637	missense	probably benign	0.01
R5038:Slco1a5	UTSW	6	142266364	missense	probably damaging	1.00
R5063:Slco1a5	UTSW	6	142259065	missense	probably damaging	1.00
R5273:Slco1a5	UTSW	6	142242098	missense	probably benign	0.00
R5436:Slco1a5	UTSW	6	142254392	missense	probably damaging	1.00
R5579:Slco1a5	UTSW	6	142242125	missense	possibly damaging	0.93
R5602:Slco1a5	UTSW	6	142275529	start gained	probably benign
R5643:Slco1a5	UTSW	6	142237594	splice site	probably null
R5644:Slco1a5	UTSW	6	142237594	splice site	probably null
R5686:Slco1a5	UTSW	6	142236307	missense	probably damaging	1.00
R5699:Slco1a5	UTSW	6	142248816	missense	probably damaging	0.96
R5792:Slco1a5	UTSW	6	142242113	missense	probably damaging	1.00
R5938:Slco1a5	UTSW	6	142248717	missense	probably damaging	0.97
R5997:Slco1a5	UTSW	6	142253113	missense	probably benign	0.19
R6146:Slco1a5	UTSW	6	142234808	missense	probably benign
R6377:Slco1a5	UTSW	6	142242180	splice site	probably null
R6466:Slco1a5	UTSW	6	142237534	missense	probably benign	0.01
R6523:Slco1a5	UTSW	6	142266395	missense	probably damaging	1.00
R7092:Slco1a5	UTSW	6	142248675	missense	probably benign
R7207:Slco1a5	UTSW	6	142248749	nonsense	probably null
R7356:Slco1a5	UTSW	6	142234732	missense	probably benign	0.01
R7430:Slco1a5	UTSW	6	142248712	missense	probably benign	0.00
R7445:Slco1a5	UTSW	6	142259008	missense	possibly damaging	0.93
R7499:Slco1a5	UTSW	6	142262531	splice site	probably null
R7579:Slco1a5	UTSW	6	142275481	missense	probably benign	0.00
R8117:Slco1a5	UTSW	6	142262692	missense	probably damaging	1.00
R8209:Slco1a5	UTSW	6	142262682	missense	probably damaging	1.00
R8217:Slco1a5	UTSW	6	142275476	missense	probably benign	0.13
R8358:Slco1a5	UTSW	6	142262685	missense	probably benign	0.45
R8710:Slco1a5	UTSW	6	142253102	missense	probably benign	0.03
R9071:Slco1a5	UTSW	6	142250326	missense	possibly damaging	0.50
R9316:Slco1a5	UTSW	6	142250209	missense	probably damaging	0.99
R9427:Slco1a5	UTSW	6	142268275	missense	probably damaging	0.98
R9619:Slco1a5	UTSW	6	142253120	missense	probably benign	0.13

Predicted Primers

PCR Primer
(F):5'- TCATAAACTTACTCACTGGTAGTCC -3'
(R):5'- GTAACTTACCTCCAATCTGCATTG -3'

Sequencing Primer
(F):5'- GGTAGTCCCCAGACCCTTTTTATAG -3'
(R):5'- TCTGCATTGGATATTTACTTATTGGC -3'

Posted On

2015-04-29