Incidental Mutation 'R0385:Atn1'
ID31218
Institutional Source Beutler Lab
Gene Symbol Atn1
Ensembl Gene ENSMUSG00000004263
Gene Nameatrophin 1
Synonymsatrophin-1, Drpla, Atr1
MMRRC Submission 038591-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0385 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location124742544-124756524 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to T at 124743371 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004377] [ENSMUST00000004389] [ENSMUST00000088357] [ENSMUST00000129411] [ENSMUST00000146872] [ENSMUST00000171549] [ENSMUST00000174265]
Predicted Effect probably benign
Transcript: ENSMUST00000004377
SMART Domains Protein: ENSMUSP00000004377
Gene: ENSMUSG00000004266

DomainStartEndE-ValueType
SH2 4 87 1.43e-28 SMART
SH2 110 202 1.45e-29 SMART
PTPc 245 519 7.51e-131 SMART
low complexity region 571 581 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000004389
SMART Domains Protein: ENSMUSP00000004389
Gene: ENSMUSG00000072772

DomainStartEndE-ValueType
Pfam:DUF4511 11 113 5e-43 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000088357
AA Change: P1118Q
SMART Domains Protein: ENSMUSP00000085695
Gene: ENSMUSG00000004263
AA Change: P1118Q

DomainStartEndE-ValueType
Pfam:Atrophin-1 1 191 7.9e-30 PFAM
low complexity region 209 218 N/A INTRINSIC
low complexity region 231 253 N/A INTRINSIC
low complexity region 256 297 N/A INTRINSIC
low complexity region 301 317 N/A INTRINSIC
low complexity region 351 372 N/A INTRINSIC
low complexity region 378 396 N/A INTRINSIC
Pfam:Atrophin-1 405 1174 4.6e-209 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000129411
AA Change: P1118Q
SMART Domains Protein: ENSMUSP00000115407
Gene: ENSMUSG00000107478
AA Change: P1118Q

DomainStartEndE-ValueType
Pfam:Atrophin-1 1 164 3.8e-33 PFAM
low complexity region 209 218 N/A INTRINSIC
low complexity region 231 253 N/A INTRINSIC
low complexity region 256 297 N/A INTRINSIC
low complexity region 301 317 N/A INTRINSIC
Pfam:Atrophin-1 327 1175 1.7e-192 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129823
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133577
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137318
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140423
Predicted Effect probably benign
Transcript: ENSMUST00000146872
SMART Domains Protein: ENSMUSP00000123560
Gene: ENSMUSG00000004263

DomainStartEndE-ValueType
Pfam:Atrophin-1 1 182 2.6e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158458
Predicted Effect probably benign
Transcript: ENSMUST00000171549
SMART Domains Protein: ENSMUSP00000129124
Gene: ENSMUSG00000004266

DomainStartEndE-ValueType
SH2 4 87 1.43e-28 SMART
SH2 110 202 1.45e-29 SMART
PTPc 245 519 7.51e-131 SMART
low complexity region 571 581 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174265
SMART Domains Protein: ENSMUSP00000133991
Gene: ENSMUSG00000004266

DomainStartEndE-ValueType
Pfam:SH2 1 40 3.5e-6 PFAM
SH2 69 161 1.45e-29 SMART
PTPc 204 478 7.51e-131 SMART
low complexity region 530 540 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dentatorubral pallidoluysian atrophy (DRPLA) is a rare neurodegenerative disorder characterized by cerebellar ataxia, myoclonic epilepsy, choreoathetosis, and dementia. The disorder is related to the expansion from 7-35 copies to 49-93 copies of a trinucleotide repeat (CAG/CAA) within this gene. The encoded protein includes a serine repeat and a region of alternating acidic and basic amino acids, as well as the variable glutamine repeat. Alternative splicing results in two transcripts variants that encode the same protein. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous null mice are viable and fertile, however mice expressing a truncated protein lacking the poly-Q repeat and C-terminal peptides display growth retardation, progressive male infertility with small testis and low sperm counts, and consume less food. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca A G 11: 84,231,748 N331S probably benign Het
Adk A G 14: 21,318,074 N189S probably benign Het
Apc T A 18: 34,315,944 N1930K probably damaging Het
Arhgap28 T C 17: 67,864,606 D391G probably damaging Het
C2cd5 T C 6: 143,041,490 E471G probably damaging Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Cap2 T C 13: 46,560,547 L34P probably damaging Het
Cdc42ep2 T A 19: 5,918,525 M51L probably benign Het
Cntn5 C T 9: 9,972,870 A254T probably damaging Het
Dicer1 A T 12: 104,704,174 L1044H probably damaging Het
Dkk3 A C 7: 112,158,223 M58R probably damaging Het
Dpy19l3 G A 7: 35,752,705 R5W probably damaging Het
Dsg1c C T 18: 20,283,654 P871S probably damaging Het
Dusp1 A T 17: 26,507,696 S131T probably benign Het
Enpp2 C T 15: 54,882,159 G314R probably damaging Het
Fam222b C A 11: 78,154,930 P439Q probably benign Het
Fastkd2 A T 1: 63,737,811 I369F probably benign Het
Fdps G A 3: 89,094,894 S205F probably damaging Het
Fmo1 A T 1: 162,836,204 V252E possibly damaging Het
Frmd5 A G 2: 121,555,574 Y230H probably damaging Het
Gal C T 19: 3,411,171 V88I probably benign Het
Gm38394 A T 1: 133,656,784 D938E probably damaging Het
Gnptab T C 10: 88,436,525 I1009T probably damaging Het
Idh2 C T 7: 80,098,257 A232T probably damaging Het
Klhdc7a A T 4: 139,966,705 D310E probably benign Het
Klk4 T C 7: 43,884,008 M97T probably benign Het
Krt82 C T 15: 101,545,593 V227M probably damaging Het
Lpp T C 16: 24,761,837 V226A probably damaging Het
Mbd1 AGCTGACTCGGTAC A 18: 74,273,241 probably null Het
Mcm10 T C 2: 5,004,154 K335E possibly damaging Het
Mpv17l A T 16: 13,940,999 I96L probably benign Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Myb T C 10: 21,154,712 D62G possibly damaging Het
Nasp A T 4: 116,610,695 N364K probably benign Het
Npsr1 A G 9: 24,313,277 N317D probably damaging Het
Nup210 A G 6: 91,028,795 V619A possibly damaging Het
Oser1 C T 2: 163,411,396 probably null Het
Pcdhb4 T C 18: 37,309,215 F526S probably damaging Het
Plekhh3 T C 11: 101,165,141 N444S probably damaging Het
Pnpla5 G T 15: 84,120,719 L144M probably damaging Het
Pou2f2 G A 7: 25,116,076 Q89* probably null Het
Ptprb A G 10: 116,350,178 I1713V probably benign Het
Ptprd A G 4: 76,128,665 Y442H probably damaging Het
Rad21 A T 15: 51,973,863 I152N possibly damaging Het
Ralgapa1 A G 12: 55,677,038 S1568P probably damaging Het
Rhag T A 17: 40,834,727 V357E probably damaging Het
Rnf121 A T 7: 102,029,117 D174E possibly damaging Het
Sdccag3 T C 2: 26,387,659 E41G possibly damaging Het
Sf3b4 T C 3: 96,172,982 Y16H probably damaging Het
Slc1a3 C T 15: 8,639,135 V449I probably damaging Het
Slc20a2 A G 8: 22,568,393 I648M probably benign Het
Slc25a25 T A 2: 32,417,822 I254F probably damaging Het
Slit3 A G 11: 35,700,282 H1307R probably damaging Het
Sorl1 C A 9: 42,031,909 M890I probably damaging Het
Supt16 A C 14: 52,176,718 M468R probably benign Het
Taf4b T C 18: 14,783,760 S56P probably benign Het
Tapt1 T C 5: 44,218,101 probably null Het
Tmco3 T G 8: 13,296,027 C288W probably damaging Het
Tpcn2 A G 7: 145,277,174 Y145H probably damaging Het
Ttn C T 2: 76,881,717 probably benign Het
Usb1 G T 8: 95,345,318 W215C probably damaging Het
Usp2 C G 9: 44,092,750 T305R probably damaging Het
Vmn1r13 G A 6: 57,210,705 S283N probably benign Het
Vps54 A G 11: 21,306,381 K467E possibly damaging Het
Wnk2 G T 13: 49,068,128 S1121Y probably damaging Het
Other mutations in Atn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Atn1 APN 6 124749276 missense probably damaging 0.96
Janvier UTSW 6 124744956 unclassified probably benign
R0122:Atn1 UTSW 6 124743234 unclassified probably benign
R0227:Atn1 UTSW 6 124746930 unclassified probably benign
R0394:Atn1 UTSW 6 124749733 splice site probably benign
R0834:Atn1 UTSW 6 124743225 unclassified probably benign
R1295:Atn1 UTSW 6 124747787 missense unknown
R1296:Atn1 UTSW 6 124747787 missense unknown
R1865:Atn1 UTSW 6 124745296 unclassified probably benign
R1992:Atn1 UTSW 6 124745328 unclassified probably benign
R2268:Atn1 UTSW 6 124746240 unclassified probably benign
R3826:Atn1 UTSW 6 124746219 unclassified probably benign
R4903:Atn1 UTSW 6 124743257 unclassified probably benign
R5601:Atn1 UTSW 6 124743228 critical splice donor site probably null
R5680:Atn1 UTSW 6 124747815 missense possibly damaging 0.92
R6167:Atn1 UTSW 6 124746737 unclassified probably benign
R6314:Atn1 UTSW 6 124747050 unclassified probably benign
R6427:Atn1 UTSW 6 124746176 unclassified probably benign
R6538:Atn1 UTSW 6 124746549 unclassified probably benign
R6606:Atn1 UTSW 6 124744956 unclassified probably benign
R7240:Atn1 UTSW 6 124747898 missense unknown
Z1177:Atn1 UTSW 6 124745035 missense unknown
Predicted Primers PCR Primer
(F):5'- AGGGACCTGGTCCAAGATACTGTG -3'
(R):5'- TCCCTTCTAAAGGAGCCTCAAGAGC -3'

Sequencing Primer
(F):5'- TCCTCCAAGGTCTGGATGAAG -3'
(R):5'- AAGAGCTAGGGCTCGTTCC -3'
Posted On2013-04-24