Incidental Mutation 'R3963:Itpkc'
ID 312182
Institutional Source Beutler Lab
Gene Symbol Itpkc
Ensembl Gene ENSMUSG00000003752
Gene Name inositol 1,4,5-trisphosphate 3-kinase C
Synonyms
MMRRC Submission 040932-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.428) question?
Stock # R3963 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 27207172-27228661 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 27227509 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 327 (T327A)
Ref Sequence ENSEMBL: ENSMUSP00000003850 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003850]
AlphaFold Q7TS72
Predicted Effect probably damaging
Transcript: ENSMUST00000003850
AA Change: T327A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000003850
Gene: ENSMUSG00000003752
AA Change: T327A

DomainStartEndE-ValueType
low complexity region 28 59 N/A INTRINSIC
low complexity region 346 363 N/A INTRINSIC
Pfam:IPK 462 673 3.7e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206441
Meta Mutation Damage Score 0.1216 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the inositol 1,4,5-trisphosphate [Ins(1,4,5)P(3)] 3-kinase family of enzymes that catalyze the phosphorylation of inositol 1,4,5-trisphosphate to 1,3,4,5-tetrakisphosphate. The encoded protein is localized to the nucleus and cytoplasm and has both nuclear import and nuclear export activity. Single nucleotide polymorphisms in this gene are associated with Kawasaki disease.[provided by RefSeq, Sep 2009]
PHENOTYPE: No overt phenotype reported. Thymocyte development was normal in homozygous null mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830010M20Rik G A 5: 107,507,356 C1007Y probably damaging Het
Adamts18 T C 8: 113,777,811 D59G probably benign Het
AF529169 G A 9: 89,601,910 T478I probably damaging Het
Ank2 A T 3: 126,934,596 S783T probably benign Het
Arfgef3 T C 10: 18,592,277 D1725G probably damaging Het
B3gnt5 A G 16: 19,769,048 S6G probably benign Het
Ccdc82 C A 9: 13,252,386 T101K possibly damaging Het
Ccdc85a A C 11: 28,576,396 M376R probably benign Het
Cd200r1 T A 16: 44,792,795 C255S probably benign Het
Cdc23 T C 18: 34,646,919 M119V probably benign Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Clptm1 C T 7: 19,638,196 W238* probably null Het
Cr2 A G 1: 195,159,739 V302A probably damaging Het
Cyp4a31 A G 4: 115,574,772 probably benign Het
Dennd4a T A 9: 64,862,331 I440N probably damaging Het
Dsc2 C T 18: 20,051,227 V35I probably damaging Het
Dyrk1a T A 16: 94,663,746 M71K probably benign Het
Exoc3l2 G A 7: 19,495,256 G200S probably benign Het
Fam160b1 T C 19: 57,373,010 L122P possibly damaging Het
Fkbp15 A T 4: 62,340,677 I114N probably damaging Het
Fpr-rs6 G A 17: 20,182,217 P294L probably damaging Het
Frmd6 A G 12: 70,893,864 T428A probably benign Het
G6pd2 T A 5: 61,808,885 M1K probably null Het
Gdf3 C T 6: 122,606,758 V217I probably benign Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Gtf3c1 T C 7: 125,693,225 probably null Het
Hrg G A 16: 22,956,075 V152I possibly damaging Het
Jade1 T C 3: 41,601,410 V304A probably damaging Het
Leo1 C A 9: 75,450,480 probably benign Het
Lrrc7 A T 3: 158,160,405 L1233Q probably damaging Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Matn2 C A 15: 34,388,791 Y342* probably null Het
Mlh3 T C 12: 85,268,680 H244R possibly damaging Het
Mmaa A T 8: 79,268,214 V321E probably damaging Het
Ntng1 T A 3: 109,934,868 L196F probably damaging Het
Oas1e A G 5: 120,794,140 V146A probably damaging Het
Olfr67 G T 7: 103,788,034 T81K probably benign Het
Plcxd2 T C 16: 45,980,501 K120R probably damaging Het
Prex2 G T 1: 11,110,357 C382F possibly damaging Het
Psg29 T A 7: 17,208,585 H170Q probably benign Het
Ptprk A G 10: 28,551,665 T747A probably damaging Het
Qk G A 17: 10,216,465 probably benign Het
Rpusd2 A G 2: 119,038,604 T503A probably benign Het
Rtn3 T C 19: 7,458,145 S142G probably damaging Het
Slco1a5 C T 6: 142,248,644 probably null Het
Snap91 A T 9: 86,775,612 W509R probably damaging Het
Srsf3 C T 17: 29,036,456 probably benign Het
Tmem267 A T 13: 119,492,639 probably null Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Tnfaip8 C A 18: 50,090,586 H154N possibly damaging Het
Trim35 T C 14: 66,304,054 L209P probably damaging Het
Ttf1 A G 2: 29,064,804 E60G possibly damaging Het
Ttf2 T C 3: 100,941,820 probably benign Het
Tubg2 T C 11: 101,160,398 probably null Het
Ubap1l C T 9: 65,369,195 probably benign Het
Usp48 A T 4: 137,633,439 R26* probably null Het
Vmn1r222 A G 13: 23,232,932 V37A probably benign Het
Vmn2r4 T A 3: 64,415,151 N49I probably damaging Het
Zfp979 A T 4: 147,613,131 C374S probably benign Het
Other mutations in Itpkc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01751:Itpkc APN 7 27213066 unclassified probably benign
IGL01774:Itpkc APN 7 27212370 missense probably benign 0.05
IGL02134:Itpkc APN 7 27227875 nonsense probably null
IGL02719:Itpkc APN 7 27228050 missense possibly damaging 0.92
R0284:Itpkc UTSW 7 27214543 nonsense probably null
R0364:Itpkc UTSW 7 27227749 missense possibly damaging 0.80
R0403:Itpkc UTSW 7 27208345 missense probably benign 0.01
R1175:Itpkc UTSW 7 27227770 missense probably benign 0.00
R1676:Itpkc UTSW 7 27208281 missense probably damaging 1.00
R1813:Itpkc UTSW 7 27208380 missense probably damaging 1.00
R1896:Itpkc UTSW 7 27208380 missense probably damaging 1.00
R1944:Itpkc UTSW 7 27227659 missense possibly damaging 0.55
R2142:Itpkc UTSW 7 27219650 missense possibly damaging 0.83
R3030:Itpkc UTSW 7 27212308 splice site probably null
R3738:Itpkc UTSW 7 27227604 missense possibly damaging 0.95
R3739:Itpkc UTSW 7 27227604 missense possibly damaging 0.95
R3754:Itpkc UTSW 7 27228432 missense probably damaging 1.00
R3851:Itpkc UTSW 7 27227612 missense probably benign 0.00
R3852:Itpkc UTSW 7 27227612 missense probably benign 0.00
R3916:Itpkc UTSW 7 27228303 missense probably benign 0.09
R5770:Itpkc UTSW 7 27212988 missense probably damaging 1.00
R5943:Itpkc UTSW 7 27212979 missense possibly damaging 0.69
R6012:Itpkc UTSW 7 27228065 missense probably damaging 0.98
R6835:Itpkc UTSW 7 27227815 missense probably benign 0.02
R7107:Itpkc UTSW 7 27228277 missense probably benign 0.15
R7379:Itpkc UTSW 7 27227769 missense probably benign 0.12
R8305:Itpkc UTSW 7 27214519 missense probably damaging 1.00
R8365:Itpkc UTSW 7 27212352 missense probably damaging 1.00
R9216:Itpkc UTSW 7 27228004 missense probably benign 0.19
R9634:Itpkc UTSW 7 27214455 missense probably benign 0.29
R9764:Itpkc UTSW 7 27227797 missense probably benign 0.00
Z1176:Itpkc UTSW 7 27227638 missense probably benign 0.01
Z1177:Itpkc UTSW 7 27227781 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CCTGGAAGAGGACTTTCTAAGC -3'
(R):5'- AGAGTGCCTTGACTCAACCTG -3'

Sequencing Primer
(F):5'- AGGACTTTCTAAGCCAAGGC -3'
(R):5'- TTGACTCAACCTGGCACTGATGG -3'
Posted On 2015-04-29