Incidental Mutation 'R3963:Dennd4a'
ID 312190
Institutional Source Beutler Lab
Gene Symbol Dennd4a
Ensembl Gene ENSMUSG00000053641
Gene Name DENN domain containing 4A
Synonyms F730015K02Rik
MMRRC Submission 040932-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.489) question?
Stock # R3963 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 64718622-64826949 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 64769613 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 440 (I440N)
Ref Sequence ENSEMBL: ENSMUSP00000037915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038890]
AlphaFold E9Q8V6
Predicted Effect probably damaging
Transcript: ENSMUST00000038890
AA Change: I440N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037915
Gene: ENSMUSG00000053641
AA Change: I440N

DomainStartEndE-ValueType
internal_repeat_1 45 93 3.26e-5 PROSPERO
uDENN 169 276 1.71e-28 SMART
DENN 309 493 2.4e-73 SMART
dDENN 559 633 4.15e-27 SMART
low complexity region 724 735 N/A INTRINSIC
low complexity region 936 950 N/A INTRINSIC
low complexity region 1176 1191 N/A INTRINSIC
low complexity region 1249 1262 N/A INTRINSIC
low complexity region 1402 1417 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215025
Meta Mutation Damage Score 0.9408 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DENN domain-containing protein that may function as a guanine nucleotide exchange factor that specifically activates ras-related protein Rab-10. This protein also contains a interferon stimulated response element-binding domain and may be involved in regulating the v-myc avian myelocytomatosis viral (MYC) oncogene. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 8. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts18 T C 8: 114,504,443 (GRCm39) D59G probably benign Het
Ank2 A T 3: 126,728,245 (GRCm39) S783T probably benign Het
Arfgef3 T C 10: 18,468,025 (GRCm39) D1725G probably damaging Het
B3gnt5 A G 16: 19,587,798 (GRCm39) S6G probably benign Het
Btbd8 G A 5: 107,655,222 (GRCm39) C1007Y probably damaging Het
Ccdc82 C A 9: 13,252,011 (GRCm39) T101K possibly damaging Het
Ccdc85a A C 11: 28,526,396 (GRCm39) M376R probably benign Het
Cd200r1 T A 16: 44,613,158 (GRCm39) C255S probably benign Het
Cdc23 T C 18: 34,779,972 (GRCm39) M119V probably benign Het
Cers3 G T 7: 66,435,823 (GRCm39) A261S probably benign Het
Clptm1 C T 7: 19,372,121 (GRCm39) W238* probably null Het
Cr2 A G 1: 194,842,047 (GRCm39) V302A probably damaging Het
Cyp4a31 A G 4: 115,431,969 (GRCm39) probably benign Het
Dsc2 C T 18: 20,184,284 (GRCm39) V35I probably damaging Het
Dyrk1a T A 16: 94,464,605 (GRCm39) M71K probably benign Het
Exoc3l2 G A 7: 19,229,181 (GRCm39) G200S probably benign Het
Fhip2a T C 19: 57,361,442 (GRCm39) L122P possibly damaging Het
Fkbp15 A T 4: 62,258,914 (GRCm39) I114N probably damaging Het
Fpr-rs6 G A 17: 20,402,479 (GRCm39) P294L probably damaging Het
Frmd6 A G 12: 70,940,638 (GRCm39) T428A probably benign Het
G6pd2 T A 5: 61,966,228 (GRCm39) M1K probably null Het
Gdf3 C T 6: 122,583,717 (GRCm39) V217I probably benign Het
Grm7 G T 6: 110,623,309 (GRCm39) V161F probably damaging Het
Gtf3c1 T C 7: 125,292,397 (GRCm39) probably null Het
Hrg G A 16: 22,774,825 (GRCm39) V152I possibly damaging Het
Itpkc T C 7: 26,926,934 (GRCm39) T327A probably damaging Het
Jade1 T C 3: 41,555,845 (GRCm39) V304A probably damaging Het
Leo1 C A 9: 75,357,762 (GRCm39) probably benign Het
Lrrc7 A T 3: 157,866,042 (GRCm39) L1233Q probably damaging Het
Ltbp3 G A 19: 5,804,050 (GRCm39) R854Q probably benign Het
Matn2 C A 15: 34,388,937 (GRCm39) Y342* probably null Het
Minar1 G A 9: 89,483,963 (GRCm39) T478I probably damaging Het
Mlh3 T C 12: 85,315,454 (GRCm39) H244R possibly damaging Het
Mmaa A T 8: 79,994,843 (GRCm39) V321E probably damaging Het
Ntng1 T A 3: 109,842,184 (GRCm39) L196F probably damaging Het
Oas1e A G 5: 120,932,205 (GRCm39) V146A probably damaging Het
Or52z1 G T 7: 103,437,241 (GRCm39) T81K probably benign Het
Plcxd2 T C 16: 45,800,864 (GRCm39) K120R probably damaging Het
Prex2 G T 1: 11,180,581 (GRCm39) C382F possibly damaging Het
Psg29 T A 7: 16,942,510 (GRCm39) H170Q probably benign Het
Ptprk A G 10: 28,427,661 (GRCm39) T747A probably damaging Het
Qki G A 17: 10,435,394 (GRCm39) probably benign Het
Rpusd2 A G 2: 118,869,085 (GRCm39) T503A probably benign Het
Rtn3 T C 19: 7,435,510 (GRCm39) S142G probably damaging Het
Slco1a5 C T 6: 142,194,370 (GRCm39) probably null Het
Snap91 A T 9: 86,657,665 (GRCm39) W509R probably damaging Het
Srsf3 C T 17: 29,255,430 (GRCm39) probably benign Het
Tmem267 A T 13: 119,629,175 (GRCm39) probably null Het
Tmem63a G A 1: 180,790,679 (GRCm39) D446N possibly damaging Het
Tnfaip8 C A 18: 50,223,653 (GRCm39) H154N possibly damaging Het
Trim35 T C 14: 66,541,503 (GRCm39) L209P probably damaging Het
Ttf1 A G 2: 28,954,816 (GRCm39) E60G possibly damaging Het
Ttf2 T C 3: 100,849,136 (GRCm39) probably benign Het
Tubg2 T C 11: 101,051,224 (GRCm39) probably null Het
Ubap1l C T 9: 65,276,477 (GRCm39) probably benign Het
Usp48 A T 4: 137,360,750 (GRCm39) R26* probably null Het
Vmn1r222 A G 13: 23,417,102 (GRCm39) V37A probably benign Het
Vmn2r4 T A 3: 64,322,572 (GRCm39) N49I probably damaging Het
Zfp979 A T 4: 147,697,588 (GRCm39) C374S probably benign Het
Other mutations in Dennd4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Dennd4a APN 9 64,819,044 (GRCm39) missense probably damaging 1.00
IGL01610:Dennd4a APN 9 64,814,166 (GRCm39) missense probably damaging 0.99
IGL01788:Dennd4a APN 9 64,749,903 (GRCm39) missense probably benign 0.00
IGL01827:Dennd4a APN 9 64,749,843 (GRCm39) nonsense probably null
IGL01828:Dennd4a APN 9 64,749,843 (GRCm39) nonsense probably null
IGL01829:Dennd4a APN 9 64,749,843 (GRCm39) nonsense probably null
IGL01979:Dennd4a APN 9 64,801,691 (GRCm39) missense probably benign 0.00
IGL02100:Dennd4a APN 9 64,816,988 (GRCm39) splice site probably benign
IGL02339:Dennd4a APN 9 64,749,843 (GRCm39) nonsense probably null
IGL02341:Dennd4a APN 9 64,749,843 (GRCm39) nonsense probably null
IGL02584:Dennd4a APN 9 64,758,580 (GRCm39) missense probably damaging 1.00
IGL02607:Dennd4a APN 9 64,769,609 (GRCm39) missense probably damaging 0.99
IGL02654:Dennd4a APN 9 64,817,473 (GRCm39) splice site probably benign
IGL02701:Dennd4a APN 9 64,804,635 (GRCm39) missense possibly damaging 0.50
IGL03051:Dennd4a APN 9 64,769,696 (GRCm39) missense probably damaging 1.00
IGL03257:Dennd4a APN 9 64,779,156 (GRCm39) missense possibly damaging 0.93
IGL03346:Dennd4a APN 9 64,795,808 (GRCm39) missense possibly damaging 0.47
IGL03349:Dennd4a APN 9 64,796,256 (GRCm39) missense probably damaging 1.00
IGL03398:Dennd4a APN 9 64,779,164 (GRCm39) missense probably benign 0.32
R0010:Dennd4a UTSW 9 64,803,997 (GRCm39) missense probably benign 0.00
R0010:Dennd4a UTSW 9 64,803,997 (GRCm39) missense probably benign 0.00
R0129:Dennd4a UTSW 9 64,800,576 (GRCm39) missense probably damaging 1.00
R0220:Dennd4a UTSW 9 64,759,727 (GRCm39) missense probably damaging 1.00
R0396:Dennd4a UTSW 9 64,769,673 (GRCm39) missense probably damaging 1.00
R0881:Dennd4a UTSW 9 64,758,665 (GRCm39) critical splice donor site probably null
R1225:Dennd4a UTSW 9 64,818,957 (GRCm39) missense probably benign 0.03
R1311:Dennd4a UTSW 9 64,817,286 (GRCm39) missense probably benign 0.34
R1448:Dennd4a UTSW 9 64,813,327 (GRCm39) missense possibly damaging 0.95
R1450:Dennd4a UTSW 9 64,818,947 (GRCm39) missense probably benign 0.03
R1630:Dennd4a UTSW 9 64,779,164 (GRCm39) missense probably benign 0.32
R1709:Dennd4a UTSW 9 64,796,887 (GRCm39) missense possibly damaging 0.92
R1824:Dennd4a UTSW 9 64,766,640 (GRCm39) critical splice donor site probably null
R1851:Dennd4a UTSW 9 64,769,312 (GRCm39) missense probably damaging 1.00
R1870:Dennd4a UTSW 9 64,804,516 (GRCm39) missense probably benign 0.00
R1900:Dennd4a UTSW 9 64,804,618 (GRCm39) missense probably damaging 0.99
R1911:Dennd4a UTSW 9 64,796,368 (GRCm39) missense probably damaging 1.00
R1938:Dennd4a UTSW 9 64,749,772 (GRCm39) missense probably damaging 1.00
R1954:Dennd4a UTSW 9 64,759,749 (GRCm39) missense probably benign 0.02
R1955:Dennd4a UTSW 9 64,759,749 (GRCm39) missense probably benign 0.02
R2049:Dennd4a UTSW 9 64,796,887 (GRCm39) missense possibly damaging 0.92
R2129:Dennd4a UTSW 9 64,813,256 (GRCm39) splice site probably null
R2138:Dennd4a UTSW 9 64,796,619 (GRCm39) missense probably damaging 1.00
R2929:Dennd4a UTSW 9 64,759,699 (GRCm39) missense possibly damaging 0.85
R3083:Dennd4a UTSW 9 64,813,363 (GRCm39) missense probably benign 0.03
R3108:Dennd4a UTSW 9 64,819,669 (GRCm39) missense probably benign 0.23
R3176:Dennd4a UTSW 9 64,796,275 (GRCm39) missense probably damaging 1.00
R3177:Dennd4a UTSW 9 64,796,275 (GRCm39) missense probably damaging 1.00
R3276:Dennd4a UTSW 9 64,796,275 (GRCm39) missense probably damaging 1.00
R3277:Dennd4a UTSW 9 64,796,275 (GRCm39) missense probably damaging 1.00
R3890:Dennd4a UTSW 9 64,779,310 (GRCm39) missense probably damaging 1.00
R3953:Dennd4a UTSW 9 64,759,857 (GRCm39) missense probably damaging 1.00
R4059:Dennd4a UTSW 9 64,819,174 (GRCm39) missense possibly damaging 0.92
R4499:Dennd4a UTSW 9 64,817,405 (GRCm39) missense possibly damaging 0.78
R4500:Dennd4a UTSW 9 64,817,405 (GRCm39) missense possibly damaging 0.78
R4501:Dennd4a UTSW 9 64,817,405 (GRCm39) missense possibly damaging 0.78
R4671:Dennd4a UTSW 9 64,801,689 (GRCm39) missense probably benign
R4701:Dennd4a UTSW 9 64,804,639 (GRCm39) missense possibly damaging 0.91
R4821:Dennd4a UTSW 9 64,804,531 (GRCm39) missense possibly damaging 0.92
R4829:Dennd4a UTSW 9 64,796,338 (GRCm39) missense probably damaging 1.00
R4876:Dennd4a UTSW 9 64,803,872 (GRCm39) missense probably benign
R4881:Dennd4a UTSW 9 64,746,126 (GRCm39) missense possibly damaging 0.77
R4962:Dennd4a UTSW 9 64,813,285 (GRCm39) missense probably benign 0.00
R5225:Dennd4a UTSW 9 64,796,210 (GRCm39) missense possibly damaging 0.94
R5557:Dennd4a UTSW 9 64,811,509 (GRCm39) missense probably benign 0.07
R5649:Dennd4a UTSW 9 64,758,491 (GRCm39) splice site probably null
R5868:Dennd4a UTSW 9 64,804,011 (GRCm39) missense probably benign 0.02
R5876:Dennd4a UTSW 9 64,819,037 (GRCm39) missense probably damaging 1.00
R6052:Dennd4a UTSW 9 64,794,227 (GRCm39) missense probably damaging 1.00
R6411:Dennd4a UTSW 9 64,779,181 (GRCm39) missense probably benign 0.04
R6596:Dennd4a UTSW 9 64,759,702 (GRCm39) missense probably damaging 1.00
R6668:Dennd4a UTSW 9 64,794,247 (GRCm39) missense probably damaging 1.00
R6915:Dennd4a UTSW 9 64,759,771 (GRCm39) nonsense probably null
R7056:Dennd4a UTSW 9 64,814,205 (GRCm39) missense possibly damaging 0.89
R7107:Dennd4a UTSW 9 64,801,681 (GRCm39) missense possibly damaging 0.79
R7203:Dennd4a UTSW 9 64,803,756 (GRCm39) missense probably benign 0.05
R7238:Dennd4a UTSW 9 64,769,238 (GRCm39) missense probably damaging 1.00
R7373:Dennd4a UTSW 9 64,804,551 (GRCm39) missense probably benign 0.01
R7454:Dennd4a UTSW 9 64,759,852 (GRCm39) missense probably damaging 1.00
R7546:Dennd4a UTSW 9 64,780,326 (GRCm39) missense probably damaging 1.00
R7590:Dennd4a UTSW 9 64,795,869 (GRCm39) missense probably benign 0.01
R7662:Dennd4a UTSW 9 64,759,713 (GRCm39) missense probably damaging 1.00
R7782:Dennd4a UTSW 9 64,814,202 (GRCm39) missense probably damaging 0.98
R7909:Dennd4a UTSW 9 64,780,275 (GRCm39) critical splice acceptor site probably null
R7976:Dennd4a UTSW 9 64,759,794 (GRCm39) missense possibly damaging 0.95
R8026:Dennd4a UTSW 9 64,780,312 (GRCm39) missense probably damaging 1.00
R8034:Dennd4a UTSW 9 64,795,850 (GRCm39) missense probably benign 0.01
R8089:Dennd4a UTSW 9 64,756,457 (GRCm39) missense probably damaging 1.00
R8298:Dennd4a UTSW 9 64,814,157 (GRCm39) missense probably benign 0.00
R8397:Dennd4a UTSW 9 64,796,391 (GRCm39) missense probably benign
R8425:Dennd4a UTSW 9 64,746,256 (GRCm39) missense probably damaging 1.00
R8495:Dennd4a UTSW 9 64,794,161 (GRCm39) missense probably damaging 1.00
R8855:Dennd4a UTSW 9 64,819,672 (GRCm39) missense probably benign
R9219:Dennd4a UTSW 9 64,796,376 (GRCm39) missense probably damaging 0.96
R9275:Dennd4a UTSW 9 64,749,906 (GRCm39) missense probably damaging 1.00
R9376:Dennd4a UTSW 9 64,819,974 (GRCm39) missense probably benign 0.00
R9485:Dennd4a UTSW 9 64,814,388 (GRCm39) nonsense probably null
R9672:Dennd4a UTSW 9 64,800,640 (GRCm39) missense probably benign
R9746:Dennd4a UTSW 9 64,801,793 (GRCm39) missense probably benign
X0026:Dennd4a UTSW 9 64,804,602 (GRCm39) missense possibly damaging 0.67
Z1088:Dennd4a UTSW 9 64,779,304 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCAGTCAGGTCAGCTTAAAC -3'
(R):5'- TGACGTCTCAAGTGTACTTACTGAG -3'

Sequencing Primer
(F):5'- CAGGTCAGCTTAAACTCAATTTATTC -3'
(R):5'- CAAGTGTACTTACTGAGAAATGGTG -3'
Posted On 2015-04-29