Incidental Mutation 'R3963:Arfgef3'
ID 312195
Institutional Source Beutler Lab
Gene Symbol Arfgef3
Ensembl Gene ENSMUSG00000019852
Gene Name ARFGEF family member 3
Synonyms B930094H20Rik, BIG3, D10Bwg1379e
MMRRC Submission 040932-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.157) question?
Stock # R3963 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 18463759-18619506 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 18468025 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 1725 (D1725G)
Ref Sequence ENSEMBL: ENSMUSP00000149210 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019999] [ENSMUST00000215836]
AlphaFold Q3UGY8
Predicted Effect probably benign
Transcript: ENSMUST00000019999
SMART Domains Protein: ENSMUSP00000019999
Gene: ENSMUSG00000019852

DomainStartEndE-ValueType
Pfam:DCB 1 170 7.1e-15 PFAM
low complexity region 236 245 N/A INTRINSIC
low complexity region 276 295 N/A INTRINSIC
low complexity region 452 462 N/A INTRINSIC
Sec7 582 794 6e-54 SMART
Blast:Sec7 798 873 3e-20 BLAST
low complexity region 927 940 N/A INTRINSIC
Pfam:DUF1981 1237 1312 1.9e-14 PFAM
low complexity region 1641 1652 N/A INTRINSIC
low complexity region 1710 1723 N/A INTRINSIC
low complexity region 1838 1856 N/A INTRINSIC
low complexity region 2088 2099 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000215836
AA Change: D1725G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.4156 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (61/61)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased insulin granule biogenesis and insulin secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts18 T C 8: 114,504,443 (GRCm39) D59G probably benign Het
Ank2 A T 3: 126,728,245 (GRCm39) S783T probably benign Het
B3gnt5 A G 16: 19,587,798 (GRCm39) S6G probably benign Het
Btbd8 G A 5: 107,655,222 (GRCm39) C1007Y probably damaging Het
Ccdc82 C A 9: 13,252,011 (GRCm39) T101K possibly damaging Het
Ccdc85a A C 11: 28,526,396 (GRCm39) M376R probably benign Het
Cd200r1 T A 16: 44,613,158 (GRCm39) C255S probably benign Het
Cdc23 T C 18: 34,779,972 (GRCm39) M119V probably benign Het
Cers3 G T 7: 66,435,823 (GRCm39) A261S probably benign Het
Clptm1 C T 7: 19,372,121 (GRCm39) W238* probably null Het
Cr2 A G 1: 194,842,047 (GRCm39) V302A probably damaging Het
Cyp4a31 A G 4: 115,431,969 (GRCm39) probably benign Het
Dennd4a T A 9: 64,769,613 (GRCm39) I440N probably damaging Het
Dsc2 C T 18: 20,184,284 (GRCm39) V35I probably damaging Het
Dyrk1a T A 16: 94,464,605 (GRCm39) M71K probably benign Het
Exoc3l2 G A 7: 19,229,181 (GRCm39) G200S probably benign Het
Fhip2a T C 19: 57,361,442 (GRCm39) L122P possibly damaging Het
Fkbp15 A T 4: 62,258,914 (GRCm39) I114N probably damaging Het
Fpr-rs6 G A 17: 20,402,479 (GRCm39) P294L probably damaging Het
Frmd6 A G 12: 70,940,638 (GRCm39) T428A probably benign Het
G6pd2 T A 5: 61,966,228 (GRCm39) M1K probably null Het
Gdf3 C T 6: 122,583,717 (GRCm39) V217I probably benign Het
Grm7 G T 6: 110,623,309 (GRCm39) V161F probably damaging Het
Gtf3c1 T C 7: 125,292,397 (GRCm39) probably null Het
Hrg G A 16: 22,774,825 (GRCm39) V152I possibly damaging Het
Itpkc T C 7: 26,926,934 (GRCm39) T327A probably damaging Het
Jade1 T C 3: 41,555,845 (GRCm39) V304A probably damaging Het
Leo1 C A 9: 75,357,762 (GRCm39) probably benign Het
Lrrc7 A T 3: 157,866,042 (GRCm39) L1233Q probably damaging Het
Ltbp3 G A 19: 5,804,050 (GRCm39) R854Q probably benign Het
Matn2 C A 15: 34,388,937 (GRCm39) Y342* probably null Het
Minar1 G A 9: 89,483,963 (GRCm39) T478I probably damaging Het
Mlh3 T C 12: 85,315,454 (GRCm39) H244R possibly damaging Het
Mmaa A T 8: 79,994,843 (GRCm39) V321E probably damaging Het
Ntng1 T A 3: 109,842,184 (GRCm39) L196F probably damaging Het
Oas1e A G 5: 120,932,205 (GRCm39) V146A probably damaging Het
Or52z1 G T 7: 103,437,241 (GRCm39) T81K probably benign Het
Plcxd2 T C 16: 45,800,864 (GRCm39) K120R probably damaging Het
Prex2 G T 1: 11,180,581 (GRCm39) C382F possibly damaging Het
Psg29 T A 7: 16,942,510 (GRCm39) H170Q probably benign Het
Ptprk A G 10: 28,427,661 (GRCm39) T747A probably damaging Het
Qki G A 17: 10,435,394 (GRCm39) probably benign Het
Rpusd2 A G 2: 118,869,085 (GRCm39) T503A probably benign Het
Rtn3 T C 19: 7,435,510 (GRCm39) S142G probably damaging Het
Slco1a5 C T 6: 142,194,370 (GRCm39) probably null Het
Snap91 A T 9: 86,657,665 (GRCm39) W509R probably damaging Het
Srsf3 C T 17: 29,255,430 (GRCm39) probably benign Het
Tmem267 A T 13: 119,629,175 (GRCm39) probably null Het
Tmem63a G A 1: 180,790,679 (GRCm39) D446N possibly damaging Het
Tnfaip8 C A 18: 50,223,653 (GRCm39) H154N possibly damaging Het
Trim35 T C 14: 66,541,503 (GRCm39) L209P probably damaging Het
Ttf1 A G 2: 28,954,816 (GRCm39) E60G possibly damaging Het
Ttf2 T C 3: 100,849,136 (GRCm39) probably benign Het
Tubg2 T C 11: 101,051,224 (GRCm39) probably null Het
Ubap1l C T 9: 65,276,477 (GRCm39) probably benign Het
Usp48 A T 4: 137,360,750 (GRCm39) R26* probably null Het
Vmn1r222 A G 13: 23,417,102 (GRCm39) V37A probably benign Het
Vmn2r4 T A 3: 64,322,572 (GRCm39) N49I probably damaging Het
Zfp979 A T 4: 147,697,588 (GRCm39) C374S probably benign Het
Other mutations in Arfgef3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00769:Arfgef3 APN 10 18,536,352 (GRCm39) missense probably benign 0.03
IGL00835:Arfgef3 APN 10 18,537,106 (GRCm39) missense probably benign
IGL00961:Arfgef3 APN 10 18,486,985 (GRCm39) missense probably damaging 1.00
IGL01400:Arfgef3 APN 10 18,528,454 (GRCm39) missense probably damaging 1.00
IGL01501:Arfgef3 APN 10 18,476,308 (GRCm39) missense possibly damaging 0.93
IGL01595:Arfgef3 APN 10 18,470,660 (GRCm39) missense possibly damaging 0.93
IGL01695:Arfgef3 APN 10 18,479,167 (GRCm39) missense probably benign 0.00
IGL01774:Arfgef3 APN 10 18,619,363 (GRCm39) missense possibly damaging 0.94
IGL02348:Arfgef3 APN 10 18,467,095 (GRCm39) missense probably benign 0.04
IGL02371:Arfgef3 APN 10 18,522,287 (GRCm39) missense probably benign
IGL02400:Arfgef3 APN 10 18,522,005 (GRCm39) missense probably damaging 1.00
IGL02630:Arfgef3 APN 10 18,537,140 (GRCm39) splice site probably benign
IGL02815:Arfgef3 APN 10 18,528,299 (GRCm39) missense probably damaging 1.00
IGL03178:Arfgef3 APN 10 18,488,973 (GRCm39) missense probably damaging 1.00
IGL03182:Arfgef3 APN 10 18,476,292 (GRCm39) missense probably damaging 1.00
IGL03267:Arfgef3 APN 10 18,467,630 (GRCm39) missense probably damaging 1.00
IGL03294:Arfgef3 APN 10 18,540,660 (GRCm39) missense probably damaging 0.97
IGL03410:Arfgef3 APN 10 18,476,238 (GRCm39) missense probably damaging 1.00
Bow-wow UTSW 10 18,522,478 (GRCm39) nonsense probably null
R0098:Arfgef3 UTSW 10 18,465,390 (GRCm39) missense probably damaging 1.00
R0098:Arfgef3 UTSW 10 18,465,390 (GRCm39) missense probably damaging 1.00
R0141:Arfgef3 UTSW 10 18,473,155 (GRCm39) missense probably damaging 1.00
R0164:Arfgef3 UTSW 10 18,523,663 (GRCm39) missense possibly damaging 0.77
R0164:Arfgef3 UTSW 10 18,523,663 (GRCm39) missense possibly damaging 0.77
R0241:Arfgef3 UTSW 10 18,474,962 (GRCm39) missense probably damaging 1.00
R0334:Arfgef3 UTSW 10 18,468,029 (GRCm39) missense probably damaging 0.98
R0352:Arfgef3 UTSW 10 18,537,135 (GRCm39) missense probably benign 0.17
R0415:Arfgef3 UTSW 10 18,488,875 (GRCm39) splice site probably benign
R0417:Arfgef3 UTSW 10 18,479,259 (GRCm39) missense probably damaging 1.00
R0442:Arfgef3 UTSW 10 18,553,563 (GRCm39) splice site probably benign
R0507:Arfgef3 UTSW 10 18,467,369 (GRCm39) missense probably damaging 1.00
R0573:Arfgef3 UTSW 10 18,475,036 (GRCm39) missense probably damaging 1.00
R0582:Arfgef3 UTSW 10 18,487,038 (GRCm39) missense probably damaging 1.00
R0609:Arfgef3 UTSW 10 18,473,179 (GRCm39) missense probably benign 0.31
R0826:Arfgef3 UTSW 10 18,465,414 (GRCm39) missense probably damaging 0.98
R0919:Arfgef3 UTSW 10 18,465,483 (GRCm39) missense possibly damaging 0.89
R0980:Arfgef3 UTSW 10 18,467,866 (GRCm39) missense possibly damaging 0.82
R1027:Arfgef3 UTSW 10 18,467,123 (GRCm39) missense probably benign 0.02
R1140:Arfgef3 UTSW 10 18,473,096 (GRCm39) missense possibly damaging 0.77
R1491:Arfgef3 UTSW 10 18,522,302 (GRCm39) missense probably damaging 1.00
R1493:Arfgef3 UTSW 10 18,506,627 (GRCm39) missense probably damaging 0.96
R1529:Arfgef3 UTSW 10 18,488,970 (GRCm39) nonsense probably null
R1564:Arfgef3 UTSW 10 18,467,452 (GRCm39) missense probably damaging 1.00
R1654:Arfgef3 UTSW 10 18,500,896 (GRCm39) missense probably null 0.15
R1868:Arfgef3 UTSW 10 18,537,135 (GRCm39) missense probably benign 0.17
R1876:Arfgef3 UTSW 10 18,473,104 (GRCm39) missense probably damaging 1.00
R1908:Arfgef3 UTSW 10 18,528,511 (GRCm39) missense possibly damaging 0.80
R2211:Arfgef3 UTSW 10 18,467,993 (GRCm39) missense possibly damaging 0.54
R2316:Arfgef3 UTSW 10 18,492,701 (GRCm39) missense probably benign 0.19
R2393:Arfgef3 UTSW 10 18,473,535 (GRCm39) missense possibly damaging 0.88
R2407:Arfgef3 UTSW 10 18,553,614 (GRCm39) missense possibly damaging 0.63
R3076:Arfgef3 UTSW 10 18,479,278 (GRCm39) missense probably damaging 0.99
R3077:Arfgef3 UTSW 10 18,479,278 (GRCm39) missense probably damaging 0.99
R4201:Arfgef3 UTSW 10 18,495,530 (GRCm39) missense probably benign 0.01
R4241:Arfgef3 UTSW 10 18,500,912 (GRCm39) missense probably damaging 1.00
R4244:Arfgef3 UTSW 10 18,506,168 (GRCm39) missense probably damaging 1.00
R4395:Arfgef3 UTSW 10 18,473,457 (GRCm39) missense probably damaging 1.00
R4455:Arfgef3 UTSW 10 18,483,423 (GRCm39) missense probably benign 0.18
R4480:Arfgef3 UTSW 10 18,476,348 (GRCm39) missense probably damaging 1.00
R4499:Arfgef3 UTSW 10 18,484,091 (GRCm39) missense possibly damaging 0.95
R4589:Arfgef3 UTSW 10 18,521,947 (GRCm39) missense probably damaging 1.00
R4635:Arfgef3 UTSW 10 18,510,603 (GRCm39) missense probably damaging 1.00
R4776:Arfgef3 UTSW 10 18,529,995 (GRCm39) missense probably benign
R4801:Arfgef3 UTSW 10 18,467,654 (GRCm39) missense probably benign 0.00
R4802:Arfgef3 UTSW 10 18,467,654 (GRCm39) missense probably benign 0.00
R4807:Arfgef3 UTSW 10 18,522,385 (GRCm39) missense probably benign
R4828:Arfgef3 UTSW 10 18,528,441 (GRCm39) missense probably damaging 0.99
R4861:Arfgef3 UTSW 10 18,483,479 (GRCm39) missense probably benign 0.01
R4861:Arfgef3 UTSW 10 18,483,479 (GRCm39) missense probably benign 0.01
R4917:Arfgef3 UTSW 10 18,492,638 (GRCm39) missense probably damaging 0.99
R4918:Arfgef3 UTSW 10 18,492,638 (GRCm39) missense probably damaging 0.99
R4922:Arfgef3 UTSW 10 18,467,934 (GRCm39) missense probably damaging 0.97
R4929:Arfgef3 UTSW 10 18,506,599 (GRCm39) missense probably benign 0.00
R4937:Arfgef3 UTSW 10 18,465,454 (GRCm39) missense probably damaging 0.98
R5290:Arfgef3 UTSW 10 18,476,208 (GRCm39) missense probably damaging 1.00
R5410:Arfgef3 UTSW 10 18,486,985 (GRCm39) missense probably damaging 0.99
R5807:Arfgef3 UTSW 10 18,523,546 (GRCm39) splice site probably null
R5832:Arfgef3 UTSW 10 18,506,168 (GRCm39) missense probably damaging 1.00
R5887:Arfgef3 UTSW 10 18,483,413 (GRCm39) nonsense probably null
R6272:Arfgef3 UTSW 10 18,522,711 (GRCm39) missense probably benign 0.00
R6302:Arfgef3 UTSW 10 18,528,589 (GRCm39) missense probably damaging 0.97
R6397:Arfgef3 UTSW 10 18,483,413 (GRCm39) nonsense probably null
R6495:Arfgef3 UTSW 10 18,486,950 (GRCm39) critical splice donor site probably null
R6707:Arfgef3 UTSW 10 18,496,903 (GRCm39) missense probably benign 0.11
R6814:Arfgef3 UTSW 10 18,470,767 (GRCm39) missense probably damaging 1.00
R6830:Arfgef3 UTSW 10 18,540,637 (GRCm39) critical splice donor site probably null
R6870:Arfgef3 UTSW 10 18,522,478 (GRCm39) nonsense probably null
R6941:Arfgef3 UTSW 10 18,501,203 (GRCm39) missense possibly damaging 0.66
R7094:Arfgef3 UTSW 10 18,522,187 (GRCm39) missense probably damaging 1.00
R7179:Arfgef3 UTSW 10 18,475,015 (GRCm39) missense probably damaging 1.00
R7204:Arfgef3 UTSW 10 18,522,210 (GRCm39) missense probably damaging 1.00
R7247:Arfgef3 UTSW 10 18,501,139 (GRCm39) missense probably benign 0.00
R7249:Arfgef3 UTSW 10 18,506,583 (GRCm39) missense possibly damaging 0.62
R7318:Arfgef3 UTSW 10 18,506,211 (GRCm39) missense possibly damaging 0.89
R7391:Arfgef3 UTSW 10 18,522,007 (GRCm39) missense probably benign 0.05
R7527:Arfgef3 UTSW 10 18,522,377 (GRCm39) missense probably benign
R7618:Arfgef3 UTSW 10 18,522,029 (GRCm39) missense probably damaging 1.00
R7779:Arfgef3 UTSW 10 18,470,771 (GRCm39) missense probably damaging 0.99
R7851:Arfgef3 UTSW 10 18,468,034 (GRCm39) missense probably damaging 1.00
R8112:Arfgef3 UTSW 10 18,528,379 (GRCm39) missense possibly damaging 0.96
R8133:Arfgef3 UTSW 10 18,486,951 (GRCm39) critical splice donor site probably null
R8242:Arfgef3 UTSW 10 18,505,824 (GRCm39) missense probably benign 0.25
R8369:Arfgef3 UTSW 10 18,465,477 (GRCm39) missense probably benign 0.34
R8396:Arfgef3 UTSW 10 18,528,280 (GRCm39) critical splice donor site probably null
R8553:Arfgef3 UTSW 10 18,479,278 (GRCm39) missense probably damaging 0.99
R8798:Arfgef3 UTSW 10 18,522,799 (GRCm39) missense probably damaging 1.00
R8821:Arfgef3 UTSW 10 18,528,491 (GRCm39) missense possibly damaging 0.95
R8831:Arfgef3 UTSW 10 18,528,491 (GRCm39) missense possibly damaging 0.95
R8918:Arfgef3 UTSW 10 18,511,453 (GRCm39) missense probably benign 0.01
R8929:Arfgef3 UTSW 10 18,479,203 (GRCm39) missense probably damaging 1.00
R9001:Arfgef3 UTSW 10 18,522,476 (GRCm39) missense probably benign 0.32
R9077:Arfgef3 UTSW 10 18,500,899 (GRCm39) missense possibly damaging 0.81
R9258:Arfgef3 UTSW 10 18,465,387 (GRCm39) missense probably damaging 1.00
R9267:Arfgef3 UTSW 10 18,475,028 (GRCm39) missense probably damaging 1.00
R9358:Arfgef3 UTSW 10 18,492,628 (GRCm39) missense probably damaging 1.00
R9388:Arfgef3 UTSW 10 18,505,877 (GRCm39) missense probably benign 0.35
R9389:Arfgef3 UTSW 10 18,479,271 (GRCm39) missense probably damaging 1.00
R9563:Arfgef3 UTSW 10 18,522,275 (GRCm39) missense probably damaging 1.00
R9713:Arfgef3 UTSW 10 18,528,556 (GRCm39) missense probably damaging 1.00
X0026:Arfgef3 UTSW 10 18,528,374 (GRCm39) missense probably damaging 1.00
Z1176:Arfgef3 UTSW 10 18,510,600 (GRCm39) missense probably benign 0.26
Z1176:Arfgef3 UTSW 10 18,484,106 (GRCm39) missense probably damaging 0.97
Z1176:Arfgef3 UTSW 10 18,467,185 (GRCm39) missense probably damaging 1.00
Z1177:Arfgef3 UTSW 10 18,503,376 (GRCm39) missense probably damaging 1.00
Z1177:Arfgef3 UTSW 10 18,483,524 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTTCAGCAGGCATTTCAGC -3'
(R):5'- AGCCAGGAATTCTATCAGCCATG -3'

Sequencing Primer
(F):5'- GCCCTGGGCTGGTGTCG -3'
(R):5'- CCTGTACACTCATCATTGTGGAAGTG -3'
Posted On 2015-04-29