Incidental Mutation 'R3963:Ptprk'
ID 312196
Institutional Source Beutler Lab
Gene Symbol Ptprk
Ensembl Gene ENSMUSG00000019889
Gene Name protein tyrosine phosphatase, receptor type, K
Synonyms RPTPkappa, PTPk
MMRRC Submission 040932-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3963 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 28074820-28597397 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 28551665 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 747 (T747A)
Ref Sequence ENSEMBL: ENSMUSP00000126279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166468] [ENSMUST00000218276] [ENSMUST00000218359]
AlphaFold P35822
Predicted Effect probably damaging
Transcript: ENSMUST00000166468
AA Change: T747A

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126279
Gene: ENSMUSG00000019889
AA Change: T747A

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
MAM 30 193 1.61e-73 SMART
IG 200 288 2.16e-8 SMART
FN3 290 373 1.48e-4 SMART
FN3 389 475 4.24e1 SMART
FN3 491 579 3.32e-7 SMART
transmembrane domain 753 774 N/A INTRINSIC
PTPc 898 1161 3.56e-132 SMART
PTPc 1190 1455 2.68e-86 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000218276
AA Change: T747A

PolyPhen 2 Score 0.139 (Sensitivity: 0.92; Specificity: 0.86)
Predicted Effect probably damaging
Transcript: ENSMUST00000218359
AA Change: T747A

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218633
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219478
Meta Mutation Damage Score 0.1095 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP mu (MAM) domain, an Ig-like domain and four fibronectin type III-like repeats. This PTP was shown to mediate homophilic intercellular interaction, possibly through the interaction with beta- and gamma-catenin at adherens junctions. Expression of this gene was found to be stimulated by TGF-beta 1, which may be important for the inhibition of keratinocyte proliferation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830010M20Rik G A 5: 107,507,356 C1007Y probably damaging Het
Adamts18 T C 8: 113,777,811 D59G probably benign Het
AF529169 G A 9: 89,601,910 T478I probably damaging Het
Ank2 A T 3: 126,934,596 S783T probably benign Het
Arfgef3 T C 10: 18,592,277 D1725G probably damaging Het
B3gnt5 A G 16: 19,769,048 S6G probably benign Het
Ccdc82 C A 9: 13,252,386 T101K possibly damaging Het
Ccdc85a A C 11: 28,576,396 M376R probably benign Het
Cd200r1 T A 16: 44,792,795 C255S probably benign Het
Cdc23 T C 18: 34,646,919 M119V probably benign Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Clptm1 C T 7: 19,638,196 W238* probably null Het
Cr2 A G 1: 195,159,739 V302A probably damaging Het
Cyp4a31 A G 4: 115,574,772 probably benign Het
Dennd4a T A 9: 64,862,331 I440N probably damaging Het
Dsc2 C T 18: 20,051,227 V35I probably damaging Het
Dyrk1a T A 16: 94,663,746 M71K probably benign Het
Exoc3l2 G A 7: 19,495,256 G200S probably benign Het
Fam160b1 T C 19: 57,373,010 L122P possibly damaging Het
Fkbp15 A T 4: 62,340,677 I114N probably damaging Het
Fpr-rs6 G A 17: 20,182,217 P294L probably damaging Het
Frmd6 A G 12: 70,893,864 T428A probably benign Het
G6pd2 T A 5: 61,808,885 M1K probably null Het
Gdf3 C T 6: 122,606,758 V217I probably benign Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Gtf3c1 T C 7: 125,693,225 probably null Het
Hrg G A 16: 22,956,075 V152I possibly damaging Het
Itpkc T C 7: 27,227,509 T327A probably damaging Het
Jade1 T C 3: 41,601,410 V304A probably damaging Het
Leo1 C A 9: 75,450,480 probably benign Het
Lrrc7 A T 3: 158,160,405 L1233Q probably damaging Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Matn2 C A 15: 34,388,791 Y342* probably null Het
Mlh3 T C 12: 85,268,680 H244R possibly damaging Het
Mmaa A T 8: 79,268,214 V321E probably damaging Het
Ntng1 T A 3: 109,934,868 L196F probably damaging Het
Oas1e A G 5: 120,794,140 V146A probably damaging Het
Olfr67 G T 7: 103,788,034 T81K probably benign Het
Plcxd2 T C 16: 45,980,501 K120R probably damaging Het
Prex2 G T 1: 11,110,357 C382F possibly damaging Het
Psg29 T A 7: 17,208,585 H170Q probably benign Het
Qk G A 17: 10,216,465 probably benign Het
Rpusd2 A G 2: 119,038,604 T503A probably benign Het
Rtn3 T C 19: 7,458,145 S142G probably damaging Het
Slco1a5 C T 6: 142,248,644 probably null Het
Snap91 A T 9: 86,775,612 W509R probably damaging Het
Srsf3 C T 17: 29,036,456 probably benign Het
Tmem267 A T 13: 119,492,639 probably null Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Tnfaip8 C A 18: 50,090,586 H154N possibly damaging Het
Trim35 T C 14: 66,304,054 L209P probably damaging Het
Ttf1 A G 2: 29,064,804 E60G possibly damaging Het
Ttf2 T C 3: 100,941,820 probably benign Het
Tubg2 T C 11: 101,160,398 probably null Het
Ubap1l C T 9: 65,369,195 probably benign Het
Usp48 A T 4: 137,633,439 R26* probably null Het
Vmn1r222 A G 13: 23,232,932 V37A probably benign Het
Vmn2r4 T A 3: 64,415,151 N49I probably damaging Het
Zfp979 A T 4: 147,613,131 C374S probably benign Het
Other mutations in Ptprk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00310:Ptprk APN 10 28336510 missense possibly damaging 0.92
IGL00533:Ptprk APN 10 28585975 missense probably damaging 0.97
IGL01062:Ptprk APN 10 28580418 missense probably damaging 1.00
IGL01295:Ptprk APN 10 28475178 missense probably benign 0.14
IGL01372:Ptprk APN 10 28569927 missense probably benign 0.00
IGL01452:Ptprk APN 10 28574917 critical splice donor site probably null
IGL01829:Ptprk APN 10 28573387 missense probably damaging 1.00
IGL01861:Ptprk APN 10 28383445 missense possibly damaging 0.80
IGL01955:Ptprk APN 10 28595865 unclassified probably benign
IGL02263:Ptprk APN 10 28075114 missense unknown
IGL02489:Ptprk APN 10 28383472 missense probably damaging 1.00
IGL02697:Ptprk APN 10 28575618 missense possibly damaging 0.85
IGL02713:Ptprk APN 10 28592811 missense possibly damaging 0.92
IGL02943:Ptprk APN 10 28475176 missense possibly damaging 0.81
IGL03240:Ptprk APN 10 28492961 missense probably damaging 0.99
IGL03373:Ptprk APN 10 28566537 missense probably damaging 1.00
LCD18:Ptprk UTSW 10 28574987 intron probably benign
PIT4366001:Ptprk UTSW 10 28586019 missense probably benign
R0010:Ptprk UTSW 10 28585969 missense probably damaging 1.00
R0021:Ptprk UTSW 10 28592895 missense probably damaging 1.00
R0021:Ptprk UTSW 10 28592895 missense probably damaging 1.00
R0035:Ptprk UTSW 10 28263508 nonsense probably null
R0035:Ptprk UTSW 10 28263508 nonsense probably null
R0053:Ptprk UTSW 10 28475109 missense probably damaging 0.99
R0063:Ptprk UTSW 10 28263767 missense probably damaging 1.00
R0063:Ptprk UTSW 10 28263767 missense probably damaging 1.00
R0244:Ptprk UTSW 10 28206225 missense possibly damaging 0.79
R0281:Ptprk UTSW 10 28573392 missense probably damaging 1.00
R0387:Ptprk UTSW 10 28354629 missense possibly damaging 0.66
R0480:Ptprk UTSW 10 28585947 missense probably damaging 1.00
R0480:Ptprk UTSW 10 28585948 missense probably damaging 1.00
R0585:Ptprk UTSW 10 28575668 missense probably damaging 1.00
R0614:Ptprk UTSW 10 28075136 missense probably damaging 0.96
R0684:Ptprk UTSW 10 28483298 splice site probably benign
R1073:Ptprk UTSW 10 28496947 critical splice donor site probably null
R1377:Ptprk UTSW 10 28586026 missense probably benign 0.42
R1422:Ptprk UTSW 10 28475280 missense possibly damaging 0.64
R1482:Ptprk UTSW 10 28263516 missense probably benign 0.24
R1532:Ptprk UTSW 10 28585630 missense probably damaging 1.00
R1576:Ptprk UTSW 10 28551651 missense probably damaging 1.00
R1618:Ptprk UTSW 10 28493170 missense probably benign 0.00
R1654:Ptprk UTSW 10 28383647 missense probably damaging 1.00
R1701:Ptprk UTSW 10 28466058 missense probably damaging 1.00
R1747:Ptprk UTSW 10 28354692 missense possibly damaging 0.78
R2033:Ptprk UTSW 10 28592767 unclassified probably benign
R2059:Ptprk UTSW 10 28566603 missense probably damaging 1.00
R2076:Ptprk UTSW 10 28589368 missense probably damaging 0.98
R2164:Ptprk UTSW 10 28560142 missense probably damaging 1.00
R2260:Ptprk UTSW 10 28206149 missense possibly damaging 0.65
R2394:Ptprk UTSW 10 28551717 missense probably damaging 0.98
R2432:Ptprk UTSW 10 28592844 missense probably damaging 1.00
R2437:Ptprk UTSW 10 28354713 missense probably damaging 1.00
R2495:Ptprk UTSW 10 28475078 splice site probably benign
R3037:Ptprk UTSW 10 28580478 missense probably damaging 1.00
R3162:Ptprk UTSW 10 28592826 missense probably benign
R3162:Ptprk UTSW 10 28592826 missense probably benign
R3687:Ptprk UTSW 10 28473043 missense probably damaging 1.00
R3722:Ptprk UTSW 10 28383623 missense probably damaging 1.00
R3892:Ptprk UTSW 10 28263621 missense probably benign 0.02
R4077:Ptprk UTSW 10 28263512 missense probably benign
R4079:Ptprk UTSW 10 28263512 missense probably benign
R4112:Ptprk UTSW 10 28475288 critical splice donor site probably null
R4255:Ptprk UTSW 10 28206245 missense probably benign 0.14
R4523:Ptprk UTSW 10 28466052 missense probably damaging 0.99
R4651:Ptprk UTSW 10 28263690 missense probably damaging 0.99
R4652:Ptprk UTSW 10 28263690 missense probably damaging 0.99
R4828:Ptprk UTSW 10 28560054 missense probably damaging 1.00
R4829:Ptprk UTSW 10 28580484 nonsense probably null
R4883:Ptprk UTSW 10 28588932 missense probably damaging 1.00
R5004:Ptprk UTSW 10 28586063 missense possibly damaging 0.95
R5013:Ptprk UTSW 10 28551717 missense probably damaging 0.99
R5092:Ptprk UTSW 10 28592773 missense probably damaging 1.00
R5126:Ptprk UTSW 10 28575644 splice site probably null
R5183:Ptprk UTSW 10 28475236 missense probably benign 0.02
R5264:Ptprk UTSW 10 28585586 missense probably damaging 1.00
R5304:Ptprk UTSW 10 28592054 splice site probably null
R5330:Ptprk UTSW 10 28587080 missense probably damaging 1.00
R5474:Ptprk UTSW 10 28496930 nonsense probably null
R5516:Ptprk UTSW 10 28496930 nonsense probably null
R5796:Ptprk UTSW 10 28383575 missense probably damaging 1.00
R5843:Ptprk UTSW 10 28493064 missense probably damaging 0.99
R5952:Ptprk UTSW 10 28585675 missense probably damaging 0.99
R6065:Ptprk UTSW 10 28475170 missense probably damaging 1.00
R6226:Ptprk UTSW 10 28564103 missense probably benign 0.02
R6264:Ptprk UTSW 10 28566673 missense probably damaging 1.00
R6638:Ptprk UTSW 10 28595811 missense probably damaging 1.00
R6843:Ptprk UTSW 10 28591982 missense possibly damaging 0.86
R6860:Ptprk UTSW 10 28334484 missense probably damaging 1.00
R6869:Ptprk UTSW 10 28473059 critical splice donor site probably null
R7214:Ptprk UTSW 10 28574909 missense probably benign 0.11
R7307:Ptprk UTSW 10 28589008 nonsense probably null
R7349:Ptprk UTSW 10 28592838 missense possibly damaging 0.85
R7442:Ptprk UTSW 10 28574819 missense probably damaging 1.00
R7585:Ptprk UTSW 10 28560088 missense probably damaging 1.00
R7661:Ptprk UTSW 10 28466040 missense probably benign 0.00
R7694:Ptprk UTSW 10 28589370 missense possibly damaging 0.63
R7740:Ptprk UTSW 10 28496924 missense probably damaging 1.00
R7810:Ptprk UTSW 10 28592857 missense probably damaging 0.97
R7831:Ptprk UTSW 10 28568408 missense possibly damaging 0.89
R7836:Ptprk UTSW 10 28573389 missense probably damaging 1.00
R8049:Ptprk UTSW 10 28383569 missense possibly damaging 0.84
R8235:Ptprk UTSW 10 28589041 missense possibly damaging 0.70
R8274:Ptprk UTSW 10 28580412 missense probably damaging 1.00
R8286:Ptprk UTSW 10 28568327 missense probably damaging 1.00
R8372:Ptprk UTSW 10 28354692 missense possibly damaging 0.78
R8727:Ptprk UTSW 10 28566545 unclassified probably benign
R8794:Ptprk UTSW 10 28263508 nonsense probably null
R8842:Ptprk UTSW 10 28566501 missense probably damaging 0.97
R8861:Ptprk UTSW 10 28570190 missense probably damaging 1.00
R8897:Ptprk UTSW 10 28591957 missense probably damaging 1.00
R8910:Ptprk UTSW 10 28492997 missense possibly damaging 0.68
R8919:Ptprk UTSW 10 28483207 nonsense probably null
R8976:Ptprk UTSW 10 28585673 missense probably damaging 1.00
R8982:Ptprk UTSW 10 28560142 missense probably damaging 1.00
R9036:Ptprk UTSW 10 28585932 missense probably benign 0.01
R9135:Ptprk UTSW 10 28580417 missense probably damaging 1.00
R9308:Ptprk UTSW 10 28574854 missense probably benign 0.15
R9317:Ptprk UTSW 10 28354735 missense probably damaging 0.96
R9475:Ptprk UTSW 10 28334480 missense possibly damaging 0.60
R9585:Ptprk UTSW 10 28493151 nonsense probably null
R9625:Ptprk UTSW 10 28586010 missense probably damaging 0.99
R9700:Ptprk UTSW 10 28580499 missense probably damaging 1.00
R9745:Ptprk UTSW 10 28263612 missense possibly damaging 0.46
Z1177:Ptprk UTSW 10 28493120 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTAACTTGACCCTAAGACTCCCATG -3'
(R):5'- CGGGCACTCTTATGAGAATTTGTC -3'

Sequencing Primer
(F):5'- AGAACAGCTCGTTTCTGCATG -3'
(R):5'- AGAATTTGTCAAGCAGCTTGG -3'
Posted On 2015-04-29