Incidental Mutation 'R3963:Fpr-rs6'
ID312212
Institutional Source Beutler Lab
Gene Symbol Fpr-rs6
Ensembl Gene ENSMUSG00000071275
Gene Nameformyl peptide receptor, related sequence 6
Synonyms
MMRRC Submission 040932-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R3963 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location20182078-20183097 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 20182217 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 294 (P294L)
Ref Sequence ENSEMBL: ENSMUSP00000093296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095636]
Predicted Effect probably damaging
Transcript: ENSMUST00000095636
AA Change: P294L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093296
Gene: ENSMUSG00000071275
AA Change: P294L

DomainStartEndE-ValueType
Pfam:7tm_1 43 297 5.7e-38 PFAM
Meta Mutation Damage Score 0.9282 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830010M20Rik G A 5: 107,507,356 C1007Y probably damaging Het
Adamts18 T C 8: 113,777,811 D59G probably benign Het
AF529169 G A 9: 89,601,910 T478I probably damaging Het
Ank2 A T 3: 126,934,596 S783T probably benign Het
Arfgef3 T C 10: 18,592,277 D1725G probably damaging Het
B3gnt5 A G 16: 19,769,048 S6G probably benign Het
Ccdc82 C A 9: 13,252,386 T101K possibly damaging Het
Ccdc85a A C 11: 28,576,396 M376R probably benign Het
Cd200r1 T A 16: 44,792,795 C255S probably benign Het
Cdc23 T C 18: 34,646,919 M119V probably benign Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Clptm1 C T 7: 19,638,196 W238* probably null Het
Cr2 A G 1: 195,159,739 V302A probably damaging Het
Cyp4a31 A G 4: 115,574,772 probably benign Het
Dennd4a T A 9: 64,862,331 I440N probably damaging Het
Dsc2 C T 18: 20,051,227 V35I probably damaging Het
Dyrk1a T A 16: 94,663,746 M71K probably benign Het
Exoc3l2 G A 7: 19,495,256 G200S probably benign Het
Fam160b1 T C 19: 57,373,010 L122P possibly damaging Het
Fkbp15 A T 4: 62,340,677 I114N probably damaging Het
Frmd6 A G 12: 70,893,864 T428A probably benign Het
G6pd2 T A 5: 61,808,885 M1K probably null Het
Gdf3 C T 6: 122,606,758 V217I probably benign Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Gtf3c1 T C 7: 125,693,225 probably null Het
Hrg G A 16: 22,956,075 V152I possibly damaging Het
Itpkc T C 7: 27,227,509 T327A probably damaging Het
Jade1 T C 3: 41,601,410 V304A probably damaging Het
Leo1 C A 9: 75,450,480 probably benign Het
Lrrc7 A T 3: 158,160,405 L1233Q probably damaging Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Matn2 C A 15: 34,388,791 Y342* probably null Het
Mlh3 T C 12: 85,268,680 H244R possibly damaging Het
Mmaa A T 8: 79,268,214 V321E probably damaging Het
Ntng1 T A 3: 109,934,868 L196F probably damaging Het
Oas1e A G 5: 120,794,140 V146A probably damaging Het
Olfr67 G T 7: 103,788,034 T81K probably benign Het
Plcxd2 T C 16: 45,980,501 K120R probably damaging Het
Prex2 G T 1: 11,110,357 C382F possibly damaging Het
Psg29 T A 7: 17,208,585 H170Q probably benign Het
Ptprk A G 10: 28,551,665 T747A probably damaging Het
Qk G A 17: 10,216,465 probably benign Het
Rpusd2 A G 2: 119,038,604 T503A probably benign Het
Rtn3 T C 19: 7,458,145 S142G probably damaging Het
Slco1a5 C T 6: 142,248,644 probably null Het
Snap91 A T 9: 86,775,612 W509R probably damaging Het
Srsf3 C T 17: 29,036,456 probably benign Het
Tmem267 A T 13: 119,492,639 probably null Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Tnfaip8 C A 18: 50,090,586 H154N possibly damaging Het
Trim35 T C 14: 66,304,054 L209P probably damaging Het
Ttf1 A G 2: 29,064,804 E60G possibly damaging Het
Ttf2 T C 3: 100,941,820 probably benign Het
Tubg2 T C 11: 101,160,398 probably null Het
Ubap1l C T 9: 65,369,195 probably benign Het
Usp48 A T 4: 137,633,439 R26* probably null Het
Vmn1r222 A G 13: 23,232,932 V37A probably benign Het
Vmn2r4 T A 3: 64,415,151 N49I probably damaging Het
Zfp979 A T 4: 147,613,131 C374S probably benign Het
Other mutations in Fpr-rs6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02836:Fpr-rs6 APN 17 20183045 missense probably benign 0.30
IGL03380:Fpr-rs6 APN 17 20182983 missense possibly damaging 0.66
R0149:Fpr-rs6 UTSW 17 20182213 missense probably benign 0.29
R0190:Fpr-rs6 UTSW 17 20182479 missense probably benign 0.07
R1347:Fpr-rs6 UTSW 17 20182749 missense probably benign 0.23
R1347:Fpr-rs6 UTSW 17 20182749 missense probably benign 0.23
R1934:Fpr-rs6 UTSW 17 20182890 missense probably benign 0.36
R1965:Fpr-rs6 UTSW 17 20182656 missense probably damaging 0.98
R3690:Fpr-rs6 UTSW 17 20182875 missense probably benign 0.02
R4564:Fpr-rs6 UTSW 17 20182906 nonsense probably null
R4574:Fpr-rs6 UTSW 17 20183097 start codon destroyed probably damaging 1.00
R5015:Fpr-rs6 UTSW 17 20182346 missense probably damaging 1.00
R5599:Fpr-rs6 UTSW 17 20182113 missense probably benign 0.05
R6737:Fpr-rs6 UTSW 17 20183077 missense probably benign 0.08
R6786:Fpr-rs6 UTSW 17 20182838 missense possibly damaging 0.95
R6908:Fpr-rs6 UTSW 17 20182439 missense probably damaging 1.00
R7040:Fpr-rs6 UTSW 17 20182934 missense probably damaging 1.00
R7462:Fpr-rs6 UTSW 17 20182223 missense probably damaging 1.00
R7673:Fpr-rs6 UTSW 17 20182737 missense probably benign 0.03
R8103:Fpr-rs6 UTSW 17 20182577 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- TGCCATCATGAGTGTCACATC -3'
(R):5'- GGCTTCAGCATACCAATGATCTTC -3'

Sequencing Primer
(F):5'- AGTGTCACATCCTATGGCTCAGAG -3'
(R):5'- TATGGACTCATGGCTGCCAAG -3'
Posted On2015-04-29