Incidental Mutation 'R3963:Dsc2'
ID312214
Institutional Source Beutler Lab
Gene Symbol Dsc2
Ensembl Gene ENSMUSG00000024331
Gene Namedesmocollin 2
SynonymsDsc2b, Dsc2a
MMRRC Submission 040932-MU
Accession Numbers

Genbank: NM_013505; MGI: 103221

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3963 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location20030633-20059554 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 20051227 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 35 (V35I)
Ref Sequence ENSEMBL: ENSMUSP00000074702 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039247] [ENSMUST00000075214] [ENSMUST00000128464]
Predicted Effect probably damaging
Transcript: ENSMUST00000039247
AA Change: V35I

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000042905
Gene: ENSMUSG00000024331
AA Change: V35I

DomainStartEndE-ValueType
Cadherin_pro 31 113 2.82e-37 SMART
CA 156 241 4.66e-11 SMART
CA 265 353 1.87e-24 SMART
low complexity region 358 372 N/A INTRINSIC
CA 376 470 1.27e-12 SMART
CA 493 575 4.14e-17 SMART
CA 594 676 1.49e-1 SMART
transmembrane domain 696 718 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000075214
AA Change: V35I

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000074702
Gene: ENSMUSG00000024331
AA Change: V35I

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Cadherin_pro 31 113 2.82e-37 SMART
CA 156 241 4.66e-11 SMART
CA 265 353 1.87e-24 SMART
low complexity region 358 372 N/A INTRINSIC
CA 376 470 1.27e-12 SMART
CA 493 575 4.14e-17 SMART
CA 594 676 1.49e-1 SMART
transmembrane domain 696 718 N/A INTRINSIC
Pfam:Cadherin_C 730 901 3.7e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000128464
AA Change: V35I

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000123010
Gene: ENSMUSG00000024331
AA Change: V35I

DomainStartEndE-ValueType
Cadherin_pro 31 113 2.82e-37 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: This gene encodes a member of the desmocollin protein subfamily. Desmocollins are cadherin-like transmembrane glycoproteins that are major components of the desmosome. Desmosomes are cell-cell junctions that help resist shearing forces and are found in high concentrations in cells subject to mechanical stress. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830010M20Rik G A 5: 107,507,356 C1007Y probably damaging Het
Adamts18 T C 8: 113,777,811 D59G probably benign Het
AF529169 G A 9: 89,601,910 T478I probably damaging Het
Ank2 A T 3: 126,934,596 S783T probably benign Het
Arfgef3 T C 10: 18,592,277 D1725G probably damaging Het
B3gnt5 A G 16: 19,769,048 S6G probably benign Het
Ccdc82 C A 9: 13,252,386 T101K possibly damaging Het
Ccdc85a A C 11: 28,576,396 M376R probably benign Het
Cd200r1 T A 16: 44,792,795 C255S probably benign Het
Cdc23 T C 18: 34,646,919 M119V probably benign Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Clptm1 C T 7: 19,638,196 W238* probably null Het
Cr2 A G 1: 195,159,739 V302A probably damaging Het
Cyp4a31 A G 4: 115,574,772 probably benign Het
Dennd4a T A 9: 64,862,331 I440N probably damaging Het
Dyrk1a T A 16: 94,663,746 M71K probably benign Het
Exoc3l2 G A 7: 19,495,256 G200S probably benign Het
Fam160b1 T C 19: 57,373,010 L122P possibly damaging Het
Fkbp15 A T 4: 62,340,677 I114N probably damaging Het
Fpr-rs6 G A 17: 20,182,217 P294L probably damaging Het
Frmd6 A G 12: 70,893,864 T428A probably benign Het
G6pd2 T A 5: 61,808,885 M1K probably null Het
Gdf3 C T 6: 122,606,758 V217I probably benign Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Gtf3c1 T C 7: 125,693,225 probably null Het
Hrg G A 16: 22,956,075 V152I possibly damaging Het
Itpkc T C 7: 27,227,509 T327A probably damaging Het
Jade1 T C 3: 41,601,410 V304A probably damaging Het
Leo1 C A 9: 75,450,480 probably benign Het
Lrrc7 A T 3: 158,160,405 L1233Q probably damaging Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Matn2 C A 15: 34,388,791 Y342* probably null Het
Mlh3 T C 12: 85,268,680 H244R possibly damaging Het
Mmaa A T 8: 79,268,214 V321E probably damaging Het
Ntng1 T A 3: 109,934,868 L196F probably damaging Het
Oas1e A G 5: 120,794,140 V146A probably damaging Het
Olfr67 G T 7: 103,788,034 T81K probably benign Het
Plcxd2 T C 16: 45,980,501 K120R probably damaging Het
Prex2 G T 1: 11,110,357 C382F possibly damaging Het
Psg29 T A 7: 17,208,585 H170Q probably benign Het
Ptprk A G 10: 28,551,665 T747A probably damaging Het
Qk G A 17: 10,216,465 probably benign Het
Rpusd2 A G 2: 119,038,604 T503A probably benign Het
Rtn3 T C 19: 7,458,145 S142G probably damaging Het
Slco1a5 C T 6: 142,248,644 probably null Het
Snap91 A T 9: 86,775,612 W509R probably damaging Het
Srsf3 C T 17: 29,036,456 probably benign Het
Tmem267 A T 13: 119,492,639 probably null Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Tnfaip8 C A 18: 50,090,586 H154N possibly damaging Het
Trim35 T C 14: 66,304,054 L209P probably damaging Het
Ttf1 A G 2: 29,064,804 E60G possibly damaging Het
Ttf2 T C 3: 100,941,820 probably benign Het
Tubg2 T C 11: 101,160,398 probably null Het
Ubap1l C T 9: 65,369,195 probably benign Het
Usp48 A T 4: 137,633,439 R26* probably null Het
Vmn1r222 A G 13: 23,232,932 V37A probably benign Het
Vmn2r4 T A 3: 64,415,151 N49I probably damaging Het
Zfp979 A T 4: 147,613,131 C374S probably benign Het
Other mutations in Dsc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00802:Dsc2 APN 18 20041797 missense probably benign 0.01
IGL00826:Dsc2 APN 18 20035315 missense probably damaging 1.00
IGL00852:Dsc2 APN 18 20034683 missense probably benign 0.01
IGL01082:Dsc2 APN 18 20043792 missense probably damaging 1.00
IGL01328:Dsc2 APN 18 20048286 missense probably damaging 0.98
IGL01338:Dsc2 APN 18 20047157 missense probably benign 0.19
IGL01727:Dsc2 APN 18 20038200 missense probably benign 0.01
IGL01766:Dsc2 APN 18 20046342 missense possibly damaging 0.56
IGL02228:Dsc2 APN 18 20043733 missense probably damaging 0.99
IGL02560:Dsc2 APN 18 20045539 missense probably damaging 1.00
IGL02794:Dsc2 APN 18 20041731 missense probably damaging 1.00
3-1:Dsc2 UTSW 18 20047079 missense possibly damaging 0.60
PIT4305001:Dsc2 UTSW 18 20046243 missense probably damaging 0.96
PIT4431001:Dsc2 UTSW 18 20046277 nonsense probably null
R0288:Dsc2 UTSW 18 20033120 missense probably damaging 1.00
R0542:Dsc2 UTSW 18 20051226 missense probably damaging 0.99
R0562:Dsc2 UTSW 18 20041537 missense probably damaging 0.99
R0697:Dsc2 UTSW 18 20041452 missense probably damaging 0.99
R0940:Dsc2 UTSW 18 20050059 missense probably damaging 0.97
R1081:Dsc2 UTSW 18 20033295 missense probably damaging 0.96
R1140:Dsc2 UTSW 18 20032212 missense probably damaging 1.00
R1515:Dsc2 UTSW 18 20034701 missense probably damaging 0.99
R1515:Dsc2 UTSW 18 20045565 missense probably benign 0.40
R1558:Dsc2 UTSW 18 20050151 missense probably damaging 0.99
R1654:Dsc2 UTSW 18 20046246 missense probably benign 0.01
R2061:Dsc2 UTSW 18 20032399 missense possibly damaging 0.79
R2089:Dsc2 UTSW 18 20033294 missense possibly damaging 0.65
R2091:Dsc2 UTSW 18 20033294 missense possibly damaging 0.65
R2091:Dsc2 UTSW 18 20033294 missense possibly damaging 0.65
R2172:Dsc2 UTSW 18 20045502 missense probably damaging 1.00
R2247:Dsc2 UTSW 18 20035312 missense probably damaging 1.00
R2472:Dsc2 UTSW 18 20045469 missense probably benign 0.00
R2927:Dsc2 UTSW 18 20045501 missense probably damaging 1.00
R3611:Dsc2 UTSW 18 20032351 missense probably damaging 0.99
R3961:Dsc2 UTSW 18 20051227 missense probably damaging 0.98
R4353:Dsc2 UTSW 18 20050068 missense probably damaging 1.00
R4362:Dsc2 UTSW 18 20050157 missense probably damaging 1.00
R4612:Dsc2 UTSW 18 20041819 missense probably damaging 1.00
R4613:Dsc2 UTSW 18 20041819 missense probably damaging 1.00
R4752:Dsc2 UTSW 18 20038222 missense probably damaging 1.00
R4946:Dsc2 UTSW 18 20050157 missense probably damaging 1.00
R5056:Dsc2 UTSW 18 20050142 missense probably damaging 1.00
R5267:Dsc2 UTSW 18 20034583 critical splice donor site probably null
R5445:Dsc2 UTSW 18 20035303 missense possibly damaging 0.76
R5507:Dsc2 UTSW 18 20046279 missense probably damaging 0.96
R5575:Dsc2 UTSW 18 20035390 missense probably damaging 1.00
R5781:Dsc2 UTSW 18 20032510 missense probably benign 0.00
R6102:Dsc2 UTSW 18 20047108 missense probably benign 0.01
R6129:Dsc2 UTSW 18 20045430 missense possibly damaging 0.95
R6362:Dsc2 UTSW 18 20035463 nonsense probably null
R6433:Dsc2 UTSW 18 20051175 critical splice donor site probably null
R6513:Dsc2 UTSW 18 20046238 missense probably benign
R6615:Dsc2 UTSW 18 20032519 missense possibly damaging 0.88
R6619:Dsc2 UTSW 18 20032278 missense probably benign 0.22
R6665:Dsc2 UTSW 18 20050148 missense probably damaging 1.00
R6961:Dsc2 UTSW 18 20038222 missense probably damaging 1.00
R7179:Dsc2 UTSW 18 20035275 critical splice donor site probably null
R7275:Dsc2 UTSW 18 20051179 nonsense probably null
R7352:Dsc2 UTSW 18 20035335 missense probably benign 0.39
R7386:Dsc2 UTSW 18 20041926 missense possibly damaging 0.84
R7496:Dsc2 UTSW 18 20035394 nonsense probably null
R7510:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R7580:Dsc2 UTSW 18 20050073 missense probably damaging 1.00
R7718:Dsc2 UTSW 18 20041778 missense probably damaging 0.98
R7733:Dsc2 UTSW 18 20048315 missense probably benign 0.00
R7733:Dsc2 UTSW 18 20048316 missense probably benign 0.16
R7818:Dsc2 UTSW 18 20050132 missense probably damaging 1.00
R7852:Dsc2 UTSW 18 20046285 missense possibly damaging 0.67
R7998:Dsc2 UTSW 18 20034663 missense possibly damaging 0.87
R8029:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8030:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8031:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8032:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8059:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8060:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8061:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8062:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8063:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8082:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8090:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8114:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8115:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8116:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8117:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8118:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8328:Dsc2 UTSW 18 20032519 missense possibly damaging 0.68
R8545:Dsc2 UTSW 18 20034665 nonsense probably null
Z1088:Dsc2 UTSW 18 20046304 missense probably damaging 0.98
Z1176:Dsc2 UTSW 18 20035299 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATCACACTGTTCGCTTTTAGC -3'
(R):5'- AAGAATGTGGTTCCCTGAGTAG -3'

Sequencing Primer
(F):5'- GCTATTAATCACAAGATCCTCCTGG -3'
(R):5'- GGAGTGCTTGGCCTTTTCTCATC -3'
Posted On2015-04-29