Mutagenetix > Incidental Mutation

Incidental Mutation 'R3963:Dsc2'

312214

Institutional Source

Beutler Lab

Gene Symbol

Dsc2

Ensembl Gene

ENSMUSG00000024331

Gene Name

desmocollin 2

Synonyms

Dsc2b, Dsc2a

MMRRC Submission

040932-MU

Accession Numbers

Genbank: NM_013505; MGI: 103221

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3963 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

20030633-20059554 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 20051227 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 35 (V35I)

Ref Sequence

ENSEMBL: ENSMUSP00000074702 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039247] [ENSMUST00000075214] [ENSMUST00000128464]

AlphaFold

P55292

Predicted Effect

probably damaging
Transcript: ENSMUST00000039247
AA Change: V35I

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000042905
Gene: ENSMUSG00000024331
AA Change: V35I

Domain	Start	End	E-Value	Type
Cadherin_pro	31	113	2.82e-37	SMART
CA	156	241	4.66e-11	SMART
CA	265	353	1.87e-24	SMART
low complexity region	358	372	N/A	INTRINSIC
CA	376	470	1.27e-12	SMART
CA	493	575	4.14e-17	SMART
CA	594	676	1.49e-1	SMART
transmembrane domain	696	718	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000075214
AA Change: V35I

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000074702
Gene: ENSMUSG00000024331
AA Change: V35I

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Cadherin_pro	31	113	2.82e-37	SMART
CA	156	241	4.66e-11	SMART
CA	265	353	1.87e-24	SMART
low complexity region	358	372	N/A	INTRINSIC
CA	376	470	1.27e-12	SMART
CA	493	575	4.14e-17	SMART
CA	594	676	1.49e-1	SMART
transmembrane domain	696	718	N/A	INTRINSIC
Pfam:Cadherin_C	730	901	3.7e-9	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000128464
AA Change: V35I

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000123010
Gene: ENSMUSG00000024331
AA Change: V35I

Domain	Start	End	E-Value	Type
Cadherin_pro	31	113	2.82e-37	SMART

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

100% (61/61)

MGI Phenotype

FUNCTION: This gene encodes a member of the desmocollin protein subfamily. Desmocollins are cadherin-like transmembrane glycoproteins that are major components of the desmosome. Desmosomes are cell-cell junctions that help resist shearing forces and are found in high concentrations in cells subject to mechanical stress. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]

Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A830010M20Rik	G	A	5: 107,507,356	C1007Y	probably damaging	Het
Adamts18	T	C	8: 113,777,811	D59G	probably benign	Het
AF529169	G	A	9: 89,601,910	T478I	probably damaging	Het
Ank2	A	T	3: 126,934,596	S783T	probably benign	Het
Arfgef3	T	C	10: 18,592,277	D1725G	probably damaging	Het
B3gnt5	A	G	16: 19,769,048	S6G	probably benign	Het
Ccdc82	C	A	9: 13,252,386	T101K	possibly damaging	Het
Ccdc85a	A	C	11: 28,576,396	M376R	probably benign	Het
Cd200r1	T	A	16: 44,792,795	C255S	probably benign	Het
Cdc23	T	C	18: 34,646,919	M119V	probably benign	Het
Cers3	G	T	7: 66,786,075	A261S	probably benign	Het
Clptm1	C	T	7: 19,638,196	W238*	probably null	Het
Cr2	A	G	1: 195,159,739	V302A	probably damaging	Het
Cyp4a31	A	G	4: 115,574,772		probably benign	Het
Dennd4a	T	A	9: 64,862,331	I440N	probably damaging	Het
Dyrk1a	T	A	16: 94,663,746	M71K	probably benign	Het
Exoc3l2	G	A	7: 19,495,256	G200S	probably benign	Het
Fam160b1	T	C	19: 57,373,010	L122P	possibly damaging	Het
Fkbp15	A	T	4: 62,340,677	I114N	probably damaging	Het
Fpr-rs6	G	A	17: 20,182,217	P294L	probably damaging	Het
Frmd6	A	G	12: 70,893,864	T428A	probably benign	Het
G6pd2	T	A	5: 61,808,885	M1K	probably null	Het
Gdf3	C	T	6: 122,606,758	V217I	probably benign	Het
Grm7	G	T	6: 110,646,348	V161F	probably damaging	Het
Gtf3c1	T	C	7: 125,693,225		probably null	Het
Hrg	G	A	16: 22,956,075	V152I	possibly damaging	Het
Itpkc	T	C	7: 27,227,509	T327A	probably damaging	Het
Jade1	T	C	3: 41,601,410	V304A	probably damaging	Het
Leo1	C	A	9: 75,450,480		probably benign	Het
Lrrc7	A	T	3: 158,160,405	L1233Q	probably damaging	Het
Ltbp3	G	A	19: 5,754,022	R854Q	probably benign	Het
Matn2	C	A	15: 34,388,791	Y342*	probably null	Het
Mlh3	T	C	12: 85,268,680	H244R	possibly damaging	Het
Mmaa	A	T	8: 79,268,214	V321E	probably damaging	Het
Ntng1	T	A	3: 109,934,868	L196F	probably damaging	Het
Oas1e	A	G	5: 120,794,140	V146A	probably damaging	Het
Olfr67	G	T	7: 103,788,034	T81K	probably benign	Het
Plcxd2	T	C	16: 45,980,501	K120R	probably damaging	Het
Prex2	G	T	1: 11,110,357	C382F	possibly damaging	Het
Psg29	T	A	7: 17,208,585	H170Q	probably benign	Het
Ptprk	A	G	10: 28,551,665	T747A	probably damaging	Het
Qk	G	A	17: 10,216,465		probably benign	Het
Rpusd2	A	G	2: 119,038,604	T503A	probably benign	Het
Rtn3	T	C	19: 7,458,145	S142G	probably damaging	Het
Slco1a5	C	T	6: 142,248,644		probably null	Het
Snap91	A	T	9: 86,775,612	W509R	probably damaging	Het
Srsf3	C	T	17: 29,036,456		probably benign	Het
Tmem267	A	T	13: 119,492,639		probably null	Het
Tmem63a	G	A	1: 180,963,114	D446N	possibly damaging	Het
Tnfaip8	C	A	18: 50,090,586	H154N	possibly damaging	Het
Trim35	T	C	14: 66,304,054	L209P	probably damaging	Het
Ttf1	A	G	2: 29,064,804	E60G	possibly damaging	Het
Ttf2	T	C	3: 100,941,820		probably benign	Het
Tubg2	T	C	11: 101,160,398		probably null	Het
Ubap1l	C	T	9: 65,369,195		probably benign	Het
Usp48	A	T	4: 137,633,439	R26*	probably null	Het
Vmn1r222	A	G	13: 23,232,932	V37A	probably benign	Het
Vmn2r4	T	A	3: 64,415,151	N49I	probably damaging	Het
Zfp979	A	T	4: 147,613,131	C374S	probably benign	Het

Other mutations in Dsc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00802:Dsc2	APN	18	20041797	missense	probably benign	0.01
IGL00826:Dsc2	APN	18	20035315	missense	probably damaging	1.00
IGL00852:Dsc2	APN	18	20034683	missense	probably benign	0.01
IGL01082:Dsc2	APN	18	20043792	missense	probably damaging	1.00
IGL01328:Dsc2	APN	18	20048286	missense	probably damaging	0.98
IGL01338:Dsc2	APN	18	20047157	missense	probably benign	0.19
IGL01727:Dsc2	APN	18	20038200	missense	probably benign	0.01
IGL01766:Dsc2	APN	18	20046342	missense	possibly damaging	0.56
IGL02228:Dsc2	APN	18	20043733	missense	probably damaging	0.99
IGL02560:Dsc2	APN	18	20045539	missense	probably damaging	1.00
IGL02794:Dsc2	APN	18	20041731	missense	probably damaging	1.00
3-1:Dsc2	UTSW	18	20047079	missense	possibly damaging	0.60
PIT4305001:Dsc2	UTSW	18	20046243	missense	probably damaging	0.96
PIT4431001:Dsc2	UTSW	18	20046277	nonsense	probably null
R0288:Dsc2	UTSW	18	20033120	missense	probably damaging	1.00
R0542:Dsc2	UTSW	18	20051226	missense	probably damaging	0.99
R0562:Dsc2	UTSW	18	20041537	missense	probably damaging	0.99
R0697:Dsc2	UTSW	18	20041452	missense	probably damaging	0.99
R0940:Dsc2	UTSW	18	20050059	missense	probably damaging	0.97
R1081:Dsc2	UTSW	18	20033295	missense	probably damaging	0.96
R1140:Dsc2	UTSW	18	20032212	missense	probably damaging	1.00
R1515:Dsc2	UTSW	18	20034701	missense	probably damaging	0.99
R1515:Dsc2	UTSW	18	20045565	missense	probably benign	0.40
R1558:Dsc2	UTSW	18	20050151	missense	probably damaging	0.99
R1654:Dsc2	UTSW	18	20046246	missense	probably benign	0.01
R2061:Dsc2	UTSW	18	20032399	missense	possibly damaging	0.79
R2089:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2091:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2091:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2172:Dsc2	UTSW	18	20045502	missense	probably damaging	1.00
R2247:Dsc2	UTSW	18	20035312	missense	probably damaging	1.00
R2472:Dsc2	UTSW	18	20045469	missense	probably benign	0.00
R2927:Dsc2	UTSW	18	20045501	missense	probably damaging	1.00
R3611:Dsc2	UTSW	18	20032351	missense	probably damaging	0.99
R3961:Dsc2	UTSW	18	20051227	missense	probably damaging	0.98
R4353:Dsc2	UTSW	18	20050068	missense	probably damaging	1.00
R4362:Dsc2	UTSW	18	20050157	missense	probably damaging	1.00
R4612:Dsc2	UTSW	18	20041819	missense	probably damaging	1.00
R4613:Dsc2	UTSW	18	20041819	missense	probably damaging	1.00
R4752:Dsc2	UTSW	18	20038222	missense	probably damaging	1.00
R4946:Dsc2	UTSW	18	20050157	missense	probably damaging	1.00
R5056:Dsc2	UTSW	18	20050142	missense	probably damaging	1.00
R5267:Dsc2	UTSW	18	20034583	critical splice donor site	probably null
R5445:Dsc2	UTSW	18	20035303	missense	possibly damaging	0.76
R5507:Dsc2	UTSW	18	20046279	missense	probably damaging	0.96
R5575:Dsc2	UTSW	18	20035390	missense	probably damaging	1.00
R5781:Dsc2	UTSW	18	20032510	missense	probably benign	0.00
R6102:Dsc2	UTSW	18	20047108	missense	probably benign	0.01
R6129:Dsc2	UTSW	18	20045430	missense	possibly damaging	0.95
R6362:Dsc2	UTSW	18	20035463	nonsense	probably null
R6433:Dsc2	UTSW	18	20051175	critical splice donor site	probably null
R6513:Dsc2	UTSW	18	20046238	missense	probably benign
R6615:Dsc2	UTSW	18	20032519	missense	possibly damaging	0.88
R6619:Dsc2	UTSW	18	20032278	missense	probably benign	0.22
R6665:Dsc2	UTSW	18	20050148	missense	probably damaging	1.00
R6961:Dsc2	UTSW	18	20038222	missense	probably damaging	1.00
R7179:Dsc2	UTSW	18	20035275	critical splice donor site	probably null
R7275:Dsc2	UTSW	18	20051179	nonsense	probably null
R7352:Dsc2	UTSW	18	20035335	missense	probably benign	0.39
R7386:Dsc2	UTSW	18	20041926	missense	possibly damaging	0.84
R7496:Dsc2	UTSW	18	20035394	nonsense	probably null
R7510:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R7580:Dsc2	UTSW	18	20050073	missense	probably damaging	1.00
R7718:Dsc2	UTSW	18	20041778	missense	probably damaging	0.98
R7733:Dsc2	UTSW	18	20048315	missense	probably benign	0.00
R7733:Dsc2	UTSW	18	20048316	missense	probably benign	0.16
R7818:Dsc2	UTSW	18	20050132	missense	probably damaging	1.00
R7852:Dsc2	UTSW	18	20046285	missense	possibly damaging	0.67
R7998:Dsc2	UTSW	18	20034663	missense	possibly damaging	0.87
R8029:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8030:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8031:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8032:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8059:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8060:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8061:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8062:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8063:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8082:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8090:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8114:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8115:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8116:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8117:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8118:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8328:Dsc2	UTSW	18	20032519	missense	possibly damaging	0.68
R8545:Dsc2	UTSW	18	20034665	nonsense	probably null
R9005:Dsc2	UTSW	18	20038094	missense	probably benign	0.00
R9017:Dsc2	UTSW	18	20043911	missense	probably damaging	1.00
R9111:Dsc2	UTSW	18	20034707	missense	probably benign	0.00
R9396:Dsc2	UTSW	18	20041716	nonsense	probably null
R9487:Dsc2	UTSW	18	20047219	missense	probably damaging	0.99
R9663:Dsc2	UTSW	18	20038148	missense	probably damaging	1.00
Z1088:Dsc2	UTSW	18	20046304	missense	probably damaging	0.98
Z1176:Dsc2	UTSW	18	20035299	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GATCACACTGTTCGCTTTTAGC -3'
(R):5'- AAGAATGTGGTTCCCTGAGTAG -3'

Sequencing Primer
(F):5'- GCTATTAATCACAAGATCCTCCTGG -3'
(R):5'- GGAGTGCTTGGCCTTTTCTCATC -3'

Posted On

2015-04-29