Incidental Mutation 'R3963:Cdc23'
ID312215
Institutional Source Beutler Lab
Gene Symbol Cdc23
Ensembl Gene ENSMUSG00000024370
Gene NameCDC23 cell division cycle 23
SynonymsD18Ertd243e
MMRRC Submission 040932-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.953) question?
Stock #R3963 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location34630951-34651735 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34646919 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 119 (M119V)
Ref Sequence ENSEMBL: ENSMUSP00000122420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025228] [ENSMUST00000133181]
Predicted Effect probably benign
Transcript: ENSMUST00000025228
AA Change: M119V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000025228
Gene: ENSMUSG00000024370
AA Change: M119V

DomainStartEndE-ValueType
Pfam:APC8 22 152 1.9e-42 PFAM
Blast:TPR 175 202 4e-10 BLAST
TPR 263 296 4.21e1 SMART
TPR 331 364 1.74e-4 SMART
TPR 365 398 1.83e-3 SMART
TPR 399 432 1.37e-2 SMART
TPR 433 466 8.97e0 SMART
TPR 510 543 1.82e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082923
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133162
Predicted Effect probably benign
Transcript: ENSMUST00000133181
AA Change: M119V

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000122420
Gene: ENSMUSG00000024370
AA Change: M119V

DomainStartEndE-ValueType
low complexity region 2 24 N/A INTRINSIC
Pfam:ANAPC8 28 151 6.9e-31 PFAM
Blast:TPR 175 202 4e-10 BLAST
TPR 263 296 4.21e1 SMART
TPR 331 364 1.74e-4 SMART
TPR 365 398 1.83e-3 SMART
TPR 399 432 1.37e-2 SMART
TPR 433 466 8.97e0 SMART
TPR 510 543 1.82e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135208
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136943
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151409
Meta Mutation Damage Score 0.1336 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares strong similarity with Saccharomyces cerevisiae Cdc23, a protein essential for cell cycle progression through the G2/M transition. This protein is a component of anaphase-promoting complex (APC), which is composed of eight protein subunits and highly conserved in eukaryotic cells. APC catalyzes the formation of cyclin B-ubiquitin conjugate that is responsible for the ubiquitin-mediated proteolysis of B-type cyclins. This protein and 3 other members of the APC complex contain the TPR (tetratricopeptide repeat), a protein domain important for protein-protein interaction. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830010M20Rik G A 5: 107,507,356 C1007Y probably damaging Het
Adamts18 T C 8: 113,777,811 D59G probably benign Het
AF529169 G A 9: 89,601,910 T478I probably damaging Het
Ank2 A T 3: 126,934,596 S783T probably benign Het
Arfgef3 T C 10: 18,592,277 D1725G probably damaging Het
B3gnt5 A G 16: 19,769,048 S6G probably benign Het
Ccdc82 C A 9: 13,252,386 T101K possibly damaging Het
Ccdc85a A C 11: 28,576,396 M376R probably benign Het
Cd200r1 T A 16: 44,792,795 C255S probably benign Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Clptm1 C T 7: 19,638,196 W238* probably null Het
Cr2 A G 1: 195,159,739 V302A probably damaging Het
Cyp4a31 A G 4: 115,574,772 probably benign Het
Dennd4a T A 9: 64,862,331 I440N probably damaging Het
Dsc2 C T 18: 20,051,227 V35I probably damaging Het
Dyrk1a T A 16: 94,663,746 M71K probably benign Het
Exoc3l2 G A 7: 19,495,256 G200S probably benign Het
Fam160b1 T C 19: 57,373,010 L122P possibly damaging Het
Fkbp15 A T 4: 62,340,677 I114N probably damaging Het
Fpr-rs6 G A 17: 20,182,217 P294L probably damaging Het
Frmd6 A G 12: 70,893,864 T428A probably benign Het
G6pd2 T A 5: 61,808,885 M1K probably null Het
Gdf3 C T 6: 122,606,758 V217I probably benign Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Gtf3c1 T C 7: 125,693,225 probably null Het
Hrg G A 16: 22,956,075 V152I possibly damaging Het
Itpkc T C 7: 27,227,509 T327A probably damaging Het
Jade1 T C 3: 41,601,410 V304A probably damaging Het
Leo1 C A 9: 75,450,480 probably benign Het
Lrrc7 A T 3: 158,160,405 L1233Q probably damaging Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Matn2 C A 15: 34,388,791 Y342* probably null Het
Mlh3 T C 12: 85,268,680 H244R possibly damaging Het
Mmaa A T 8: 79,268,214 V321E probably damaging Het
Ntng1 T A 3: 109,934,868 L196F probably damaging Het
Oas1e A G 5: 120,794,140 V146A probably damaging Het
Olfr67 G T 7: 103,788,034 T81K probably benign Het
Plcxd2 T C 16: 45,980,501 K120R probably damaging Het
Prex2 G T 1: 11,110,357 C382F possibly damaging Het
Psg29 T A 7: 17,208,585 H170Q probably benign Het
Ptprk A G 10: 28,551,665 T747A probably damaging Het
Qk G A 17: 10,216,465 probably benign Het
Rpusd2 A G 2: 119,038,604 T503A probably benign Het
Rtn3 T C 19: 7,458,145 S142G probably damaging Het
Slco1a5 C T 6: 142,248,644 probably null Het
Snap91 A T 9: 86,775,612 W509R probably damaging Het
Srsf3 C T 17: 29,036,456 probably benign Het
Tmem267 A T 13: 119,492,639 probably null Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Tnfaip8 C A 18: 50,090,586 H154N possibly damaging Het
Trim35 T C 14: 66,304,054 L209P probably damaging Het
Ttf1 A G 2: 29,064,804 E60G possibly damaging Het
Ttf2 T C 3: 100,941,820 probably benign Het
Tubg2 T C 11: 101,160,398 probably null Het
Ubap1l C T 9: 65,369,195 probably benign Het
Usp48 A T 4: 137,633,439 R26* probably null Het
Vmn1r222 A G 13: 23,232,932 V37A probably benign Het
Vmn2r4 T A 3: 64,415,151 N49I probably damaging Het
Zfp979 A T 4: 147,613,131 C374S probably benign Het
Other mutations in Cdc23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01140:Cdc23 APN 18 34636332 missense probably benign 0.01
IGL01302:Cdc23 APN 18 34634644 missense probably benign 0.19
IGL01859:Cdc23 APN 18 34651406 missense probably benign 0.01
IGL02307:Cdc23 APN 18 34641389 missense possibly damaging 0.71
IGL03081:Cdc23 APN 18 34636704 missense probably damaging 1.00
IGL03086:Cdc23 APN 18 34637186 unclassified probably benign
IGL03089:Cdc23 APN 18 34634460 missense probably damaging 1.00
IGL03249:Cdc23 APN 18 34644016 splice site probably benign
R0217:Cdc23 UTSW 18 34651665 missense unknown
R0790:Cdc23 UTSW 18 34651613 missense possibly damaging 0.94
R1593:Cdc23 UTSW 18 34636326 missense possibly damaging 0.88
R2929:Cdc23 UTSW 18 34637318 frame shift probably null
R2930:Cdc23 UTSW 18 34637318 frame shift probably null
R3983:Cdc23 UTSW 18 34637486 unclassified probably benign
R4245:Cdc23 UTSW 18 34637047 unclassified probably benign
R4415:Cdc23 UTSW 18 34637318 frame shift probably null
R4417:Cdc23 UTSW 18 34637318 frame shift probably null
R4992:Cdc23 UTSW 18 34646919 missense probably benign
R5037:Cdc23 UTSW 18 34651689 missense unknown
R5071:Cdc23 UTSW 18 34651689 missense unknown
R5072:Cdc23 UTSW 18 34651689 missense unknown
R5073:Cdc23 UTSW 18 34651689 missense unknown
R5074:Cdc23 UTSW 18 34651689 missense unknown
R5081:Cdc23 UTSW 18 34651689 missense unknown
R5082:Cdc23 UTSW 18 34651689 missense unknown
R5083:Cdc23 UTSW 18 34651689 missense unknown
R5110:Cdc23 UTSW 18 34651689 missense unknown
R5111:Cdc23 UTSW 18 34651689 missense unknown
R5122:Cdc23 UTSW 18 34651689 missense unknown
R5131:Cdc23 UTSW 18 34651689 missense unknown
R5132:Cdc23 UTSW 18 34651689 missense unknown
R5166:Cdc23 UTSW 18 34651689 missense unknown
R7186:Cdc23 UTSW 18 34637122 missense probably damaging 1.00
R7359:Cdc23 UTSW 18 34641341 missense probably benign 0.40
R7732:Cdc23 UTSW 18 34636702 critical splice donor site probably null
R7832:Cdc23 UTSW 18 34647019 missense probably benign 0.11
R7915:Cdc23 UTSW 18 34647019 missense probably benign 0.11
R8031:Cdc23 UTSW 18 34651688 missense unknown
Predicted Primers PCR Primer
(F):5'- ATCAAGTTGAGGGTCAGCCTG -3'
(R):5'- AACTCTGGCTGTCTGAGACC -3'

Sequencing Primer
(F):5'- TCAGACCTCTGCTGGTACTAGG -3'
(R):5'- TGGCTGTCTGAGACCTAACCAC -3'
Posted On2015-04-29