Incidental Mutation 'R3964:Plxna2'
ID 312224
Institutional Source Beutler Lab
Gene Symbol Plxna2
Ensembl Gene ENSMUSG00000026640
Gene Name plexin A2
Synonyms PlexA2, 2810428A13Rik, Plxn2, OCT
MMRRC Submission 040933-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3964 (G1)
Quality Score 220
Status Validated
Chromosome 1
Chromosomal Location 194302020-194499177 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 194431625 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Phenylalanine at position 538 (S538F)
Ref Sequence ENSEMBL: ENSMUSP00000027952 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027952]
AlphaFold P70207
PDB Structure Plexin A2 / Semaphorin 6A complex [X-RAY DIFFRACTION]
Mouse Plexin A2 extracellular domain [X-RAY DIFFRACTION]
Mouse Plexin A2, extracellular domains 1-4 [X-RAY DIFFRACTION]
Plexin A2 in complex with Semaphorin 6A [X-RAY DIFFRACTION]
Complex of mouse Plexin A2 - Semaphorin 3A - Neuropilin-1 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000027952
AA Change: S538F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027952
Gene: ENSMUSG00000026640
AA Change: S538F

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
Sema 50 492 1.65e-132 SMART
PSI 510 560 8e-12 SMART
PSI 655 702 6.35e-6 SMART
PSI 803 856 1.24e-8 SMART
IPT 857 952 6.36e-21 SMART
IPT 953 1038 1.02e-24 SMART
IPT 1040 1140 1.48e-21 SMART
IPT 1142 1237 8.81e-6 SMART
transmembrane domain 1238 1260 N/A INTRINSIC
Pfam:Plexin_cytopl 1311 1864 1.9e-261 PFAM
Meta Mutation Damage Score 0.7688 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the plexin-A family of semaphorin co-receptors. Semaphorins are a large family of secreted or membrane-bound proteins that mediate repulsive effects on axon pathfinding during nervous system development. A subset of semaphorins are recognized by plexin-A/neuropilin transmembrane receptor complexes, triggering a cellular signal transduction cascade that leads to axon repulsion. This plexin-A family member is thought to transduce signals from semaphorin-3A and -3C. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show abnormal granule cell migration in the adult cerebellum and aberrant projection of mossy fibers in hippocampal slices. Mice homozygous for an ENU-induced allele are smaller and show granule cell migration defects and mild ataxia with incomplete penetrance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam21 C A 12: 81,607,583 (GRCm39) A60S possibly damaging Het
Arpp21 C G 9: 111,894,844 (GRCm39) V805L probably damaging Het
C1galt1c1 A T X: 37,720,453 (GRCm39) V181E probably benign Het
Cdh18 A T 15: 23,474,187 (GRCm39) T686S probably benign Het
Cemip T A 7: 83,600,717 (GRCm39) Y968F probably benign Het
Cep70 T A 9: 99,180,587 (GRCm39) F581I probably damaging Het
Ctc1 T A 11: 68,921,954 (GRCm39) V800D probably damaging Het
Cttnbp2nl T C 3: 104,913,321 (GRCm39) K188E probably damaging Het
Cux1 A G 5: 136,311,796 (GRCm39) V1180A probably damaging Het
Cux2 G T 5: 122,025,539 (GRCm39) S43* probably null Het
Dhx57 T A 17: 80,572,541 (GRCm39) K711* probably null Het
Ehbp1l1 C T 19: 5,760,601 (GRCm39) probably null Het
Esyt3 T A 9: 99,202,375 (GRCm39) D512V probably damaging Het
Gadl1 T C 9: 115,794,676 (GRCm39) S284P probably damaging Het
Gm14137 T A 2: 119,005,497 (GRCm39) S19T probably benign Het
Gpr141b A G 13: 19,913,614 (GRCm39) noncoding transcript Het
Gprc6a CAAA CA 10: 51,491,776 (GRCm39) probably null Het
Gsdmc2 A G 15: 63,721,683 (GRCm39) probably benign Het
Hmcn1 T C 1: 150,449,320 (GRCm39) T110A probably benign Het
Il23r G A 6: 67,443,281 (GRCm39) T274I probably benign Het
Inhbb C A 1: 119,345,291 (GRCm39) G333W probably damaging Het
Kcnb1 C T 2: 166,946,412 (GRCm39) C812Y probably damaging Het
Lrp1b A G 2: 41,202,482 (GRCm39) probably benign Het
Med31 C T 11: 72,102,755 (GRCm39) A118T probably benign Het
Mov10l1 A G 15: 88,896,366 (GRCm39) I737V probably benign Het
Mrs2 A G 13: 25,185,746 (GRCm39) I142T possibly damaging Het
Ms4a6b T C 19: 11,499,098 (GRCm39) S71P probably benign Het
Muc2 G A 7: 141,286,233 (GRCm39) R120H probably benign Het
Muc5b A T 7: 141,420,705 (GRCm39) I4191F possibly damaging Het
Myrf T C 19: 10,196,979 (GRCm39) E267G probably benign Het
Nfatc2 C T 2: 168,346,469 (GRCm39) S875N probably benign Het
Nmi T C 2: 51,846,081 (GRCm39) E67G possibly damaging Het
Nrap T C 19: 56,330,576 (GRCm39) S1126G probably damaging Het
Nucb2 A G 7: 116,128,110 (GRCm39) E273G probably damaging Het
Or10g9 A T 9: 39,911,767 (GRCm39) V252E possibly damaging Het
Or1j4 A G 2: 36,740,729 (GRCm39) T224A probably benign Het
Or8b1b T C 9: 38,375,979 (GRCm39) I214T probably benign Het
Or8b51 G A 9: 38,569,023 (GRCm39) L222F probably benign Het
Pcdhga12 A T 18: 37,900,254 (GRCm39) Q362L probably benign Het
Peak1 C T 9: 56,167,263 (GRCm39) E222K probably damaging Het
Pik3r1 T C 13: 101,825,193 (GRCm39) E458G possibly damaging Het
Pls1 T C 9: 95,667,665 (GRCm39) Q81R probably benign Het
Plxdc2 T A 2: 16,665,651 (GRCm39) F284I probably damaging Het
Pole A G 5: 110,460,648 (GRCm39) K1143E probably damaging Het
Ppfia4 A T 1: 134,250,754 (GRCm39) D478E probably benign Het
Ptprd A G 4: 75,978,073 (GRCm39) probably benign Het
Ptprj A G 2: 90,298,785 (GRCm39) I315T probably benign Het
Rims1 T C 1: 22,497,709 (GRCm39) probably null Het
Rnf13 G A 3: 57,676,533 (GRCm39) G63S probably damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,229,114 (GRCm39) probably benign Het
Shld2 T A 14: 33,981,644 (GRCm39) Q498L probably damaging Het
Slc50a1 T C 3: 89,176,093 (GRCm39) I151V probably benign Het
Snx27 T A 3: 94,438,613 (GRCm39) R207S probably damaging Het
Sos1 C T 17: 80,762,608 (GRCm39) R73H probably damaging Het
Tbc1d9b A G 11: 50,059,523 (GRCm39) E975G possibly damaging Het
Tbccd1 A G 16: 22,660,523 (GRCm39) S98P probably damaging Het
Timd5 T A 11: 46,426,340 (GRCm39) V149D possibly damaging Het
Tmx4 T C 2: 134,441,981 (GRCm39) I206V possibly damaging Het
Upf1 C T 8: 70,791,110 (GRCm39) R544H probably damaging Het
Usp19 T A 9: 108,375,228 (GRCm39) V818E probably damaging Het
Wdr38 A G 2: 38,889,362 (GRCm39) Y51C probably damaging Het
Zfp456 T C 13: 67,514,900 (GRCm39) T269A probably benign Het
Zfp628 T C 7: 4,924,744 (GRCm39) S989P probably benign Het
Other mutations in Plxna2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Plxna2 APN 1 194,326,965 (GRCm39) missense probably damaging 1.00
IGL00332:Plxna2 APN 1 194,472,138 (GRCm39) missense probably damaging 0.98
IGL00392:Plxna2 APN 1 194,482,876 (GRCm39) missense probably damaging 1.00
IGL00432:Plxna2 APN 1 194,326,404 (GRCm39) missense probably benign 0.03
IGL00704:Plxna2 APN 1 194,433,769 (GRCm39) missense probably damaging 0.99
IGL00737:Plxna2 APN 1 194,428,547 (GRCm39) splice site probably benign
IGL01078:Plxna2 APN 1 194,469,001 (GRCm39) unclassified probably benign
IGL01354:Plxna2 APN 1 194,444,743 (GRCm39) missense probably benign 0.02
IGL01432:Plxna2 APN 1 194,326,626 (GRCm39) missense possibly damaging 0.58
IGL01459:Plxna2 APN 1 194,446,878 (GRCm39) missense probably benign 0.00
IGL01525:Plxna2 APN 1 194,394,619 (GRCm39) missense probably benign 0.00
IGL01656:Plxna2 APN 1 194,472,469 (GRCm39) missense possibly damaging 0.52
IGL01825:Plxna2 APN 1 194,471,210 (GRCm39) missense probably damaging 0.98
IGL01862:Plxna2 APN 1 194,326,258 (GRCm39) missense possibly damaging 0.87
IGL01899:Plxna2 APN 1 194,433,796 (GRCm39) missense probably damaging 1.00
IGL01996:Plxna2 APN 1 194,482,084 (GRCm39) missense probably damaging 0.99
IGL02123:Plxna2 APN 1 194,476,691 (GRCm39) missense probably damaging 1.00
IGL02226:Plxna2 APN 1 194,326,732 (GRCm39) missense probably damaging 1.00
IGL02227:Plxna2 APN 1 194,434,397 (GRCm39) missense probably damaging 1.00
IGL02415:Plxna2 APN 1 194,326,272 (GRCm39) missense probably damaging 1.00
IGL02440:Plxna2 APN 1 194,428,458 (GRCm39) missense probably benign 0.10
IGL02545:Plxna2 APN 1 194,468,998 (GRCm39) unclassified probably benign
IGL02553:Plxna2 APN 1 194,433,746 (GRCm39) missense probably benign 0.08
IGL02882:Plxna2 APN 1 194,444,878 (GRCm39) missense probably damaging 1.00
IGL02946:Plxna2 APN 1 194,431,617 (GRCm39) splice site probably benign
IGL03062:Plxna2 APN 1 194,444,858 (GRCm39) missense possibly damaging 0.72
IGL03095:Plxna2 APN 1 194,483,435 (GRCm39) missense probably damaging 1.00
IGL03293:Plxna2 APN 1 194,487,253 (GRCm39) missense probably damaging 0.99
G1Funyon:Plxna2 UTSW 1 194,472,483 (GRCm39) missense probably benign 0.01
PIT4514001:Plxna2 UTSW 1 194,477,245 (GRCm39) missense probably benign 0.00
R0024:Plxna2 UTSW 1 194,326,303 (GRCm39) missense possibly damaging 0.57
R0040:Plxna2 UTSW 1 194,326,204 (GRCm39) missense probably benign 0.13
R0040:Plxna2 UTSW 1 194,326,204 (GRCm39) missense probably benign 0.13
R0063:Plxna2 UTSW 1 194,327,247 (GRCm39) missense probably benign 0.00
R0063:Plxna2 UTSW 1 194,327,247 (GRCm39) missense probably benign 0.00
R0217:Plxna2 UTSW 1 194,326,906 (GRCm39) missense probably damaging 1.00
R0316:Plxna2 UTSW 1 194,326,458 (GRCm39) missense probably damaging 1.00
R0440:Plxna2 UTSW 1 194,326,712 (GRCm39) nonsense probably null
R0505:Plxna2 UTSW 1 194,326,656 (GRCm39) missense possibly damaging 0.93
R0568:Plxna2 UTSW 1 194,433,694 (GRCm39) missense probably benign 0.00
R0669:Plxna2 UTSW 1 194,471,145 (GRCm39) missense probably damaging 0.99
R0674:Plxna2 UTSW 1 194,331,783 (GRCm39) missense probably benign 0.00
R0885:Plxna2 UTSW 1 194,326,864 (GRCm39) missense probably benign
R0898:Plxna2 UTSW 1 194,479,332 (GRCm39) missense probably damaging 1.00
R0940:Plxna2 UTSW 1 194,482,863 (GRCm39) missense probably benign 0.01
R1061:Plxna2 UTSW 1 194,326,401 (GRCm39) missense probably damaging 1.00
R1067:Plxna2 UTSW 1 194,462,818 (GRCm39) splice site probably null
R1222:Plxna2 UTSW 1 194,482,957 (GRCm39) missense probably damaging 1.00
R1345:Plxna2 UTSW 1 194,326,794 (GRCm39) missense probably damaging 1.00
R1363:Plxna2 UTSW 1 194,487,247 (GRCm39) nonsense probably null
R1432:Plxna2 UTSW 1 194,449,771 (GRCm39) missense probably benign 0.10
R1434:Plxna2 UTSW 1 194,433,848 (GRCm39) splice site probably benign
R1597:Plxna2 UTSW 1 194,431,614 (GRCm39) splice site probably benign
R1719:Plxna2 UTSW 1 194,326,678 (GRCm39) missense possibly damaging 0.93
R1778:Plxna2 UTSW 1 194,493,278 (GRCm39) missense probably benign 0.01
R1795:Plxna2 UTSW 1 194,488,611 (GRCm39) missense probably damaging 0.99
R1819:Plxna2 UTSW 1 194,472,494 (GRCm39) missense probably benign 0.03
R1926:Plxna2 UTSW 1 194,444,758 (GRCm39) missense probably benign 0.02
R1966:Plxna2 UTSW 1 194,327,008 (GRCm39) missense possibly damaging 0.91
R1987:Plxna2 UTSW 1 194,326,297 (GRCm39) missense probably damaging 1.00
R1988:Plxna2 UTSW 1 194,326,297 (GRCm39) missense probably damaging 1.00
R2034:Plxna2 UTSW 1 194,462,902 (GRCm39) missense probably benign 0.00
R2131:Plxna2 UTSW 1 194,327,058 (GRCm39) missense probably benign 0.01
R2171:Plxna2 UTSW 1 194,482,925 (GRCm39) missense probably damaging 1.00
R2217:Plxna2 UTSW 1 194,480,056 (GRCm39) missense probably damaging 1.00
R2311:Plxna2 UTSW 1 194,431,625 (GRCm39) missense probably damaging 1.00
R2340:Plxna2 UTSW 1 194,431,625 (GRCm39) missense probably damaging 1.00
R2342:Plxna2 UTSW 1 194,431,625 (GRCm39) missense probably damaging 1.00
R2423:Plxna2 UTSW 1 194,431,625 (GRCm39) missense probably damaging 1.00
R2424:Plxna2 UTSW 1 194,431,625 (GRCm39) missense probably damaging 1.00
R2425:Plxna2 UTSW 1 194,431,625 (GRCm39) missense probably damaging 1.00
R2842:Plxna2 UTSW 1 194,431,625 (GRCm39) missense probably damaging 1.00
R2971:Plxna2 UTSW 1 194,480,039 (GRCm39) missense probably damaging 1.00
R3236:Plxna2 UTSW 1 194,431,625 (GRCm39) missense probably damaging 1.00
R3731:Plxna2 UTSW 1 194,471,193 (GRCm39) missense probably benign 0.42
R3783:Plxna2 UTSW 1 194,489,829 (GRCm39) missense probably damaging 1.00
R3784:Plxna2 UTSW 1 194,326,925 (GRCm39) missense probably benign
R3787:Plxna2 UTSW 1 194,326,242 (GRCm39) missense probably benign 0.10
R3845:Plxna2 UTSW 1 194,476,098 (GRCm39) missense probably damaging 0.96
R3927:Plxna2 UTSW 1 194,428,465 (GRCm39) missense probably benign 0.02
R3930:Plxna2 UTSW 1 194,477,218 (GRCm39) missense probably benign 0.17
R3980:Plxna2 UTSW 1 194,431,625 (GRCm39) missense probably damaging 1.00
R4067:Plxna2 UTSW 1 194,431,625 (GRCm39) missense probably damaging 1.00
R4120:Plxna2 UTSW 1 194,462,935 (GRCm39) missense probably damaging 1.00
R4231:Plxna2 UTSW 1 194,326,762 (GRCm39) missense probably damaging 1.00
R4257:Plxna2 UTSW 1 194,327,083 (GRCm39) missense probably damaging 1.00
R4396:Plxna2 UTSW 1 194,431,625 (GRCm39) missense probably damaging 1.00
R4397:Plxna2 UTSW 1 194,431,625 (GRCm39) missense probably damaging 1.00
R4418:Plxna2 UTSW 1 194,431,625 (GRCm39) missense probably damaging 1.00
R4444:Plxna2 UTSW 1 194,431,625 (GRCm39) missense probably damaging 1.00
R4446:Plxna2 UTSW 1 194,431,625 (GRCm39) missense probably damaging 1.00
R4482:Plxna2 UTSW 1 194,431,625 (GRCm39) missense probably damaging 1.00
R4487:Plxna2 UTSW 1 194,431,625 (GRCm39) missense probably damaging 1.00
R4489:Plxna2 UTSW 1 194,431,625 (GRCm39) missense probably damaging 1.00
R4571:Plxna2 UTSW 1 194,493,296 (GRCm39) missense possibly damaging 0.91
R4622:Plxna2 UTSW 1 194,494,458 (GRCm39) missense probably benign
R4623:Plxna2 UTSW 1 194,494,458 (GRCm39) missense probably benign
R4684:Plxna2 UTSW 1 194,444,902 (GRCm39) missense probably benign 0.42
R4688:Plxna2 UTSW 1 194,326,753 (GRCm39) missense probably damaging 1.00
R4855:Plxna2 UTSW 1 194,480,040 (GRCm39) missense probably benign 0.39
R4876:Plxna2 UTSW 1 194,326,083 (GRCm39) missense probably benign 0.02
R5161:Plxna2 UTSW 1 194,433,712 (GRCm39) missense probably benign
R5207:Plxna2 UTSW 1 194,471,207 (GRCm39) missense probably benign 0.19
R5479:Plxna2 UTSW 1 194,476,181 (GRCm39) missense probably benign
R5931:Plxna2 UTSW 1 194,493,178 (GRCm39) missense probably damaging 1.00
R6026:Plxna2 UTSW 1 194,482,122 (GRCm39) missense probably damaging 1.00
R6029:Plxna2 UTSW 1 194,481,883 (GRCm39) missense probably damaging 1.00
R6029:Plxna2 UTSW 1 194,476,735 (GRCm39) missense probably benign 0.00
R6059:Plxna2 UTSW 1 194,493,279 (GRCm39) missense possibly damaging 0.79
R6238:Plxna2 UTSW 1 194,472,504 (GRCm39) missense probably benign 0.01
R6322:Plxna2 UTSW 1 194,436,675 (GRCm39) missense possibly damaging 0.89
R6668:Plxna2 UTSW 1 194,492,396 (GRCm39) missense possibly damaging 0.68
R6709:Plxna2 UTSW 1 194,472,074 (GRCm39) missense probably benign 0.01
R6748:Plxna2 UTSW 1 194,476,490 (GRCm39) splice site probably null
R6838:Plxna2 UTSW 1 194,487,222 (GRCm39) missense possibly damaging 0.90
R6844:Plxna2 UTSW 1 194,476,136 (GRCm39) missense probably benign 0.08
R7069:Plxna2 UTSW 1 194,476,212 (GRCm39) missense possibly damaging 0.51
R7122:Plxna2 UTSW 1 194,326,876 (GRCm39) nonsense probably null
R7145:Plxna2 UTSW 1 194,331,830 (GRCm39) missense probably benign 0.31
R7189:Plxna2 UTSW 1 194,483,366 (GRCm39) missense possibly damaging 0.58
R7207:Plxna2 UTSW 1 194,326,327 (GRCm39) missense probably damaging 1.00
R7232:Plxna2 UTSW 1 194,394,568 (GRCm39) missense probably damaging 1.00
R7234:Plxna2 UTSW 1 194,488,698 (GRCm39) missense probably damaging 0.96
R7246:Plxna2 UTSW 1 194,326,590 (GRCm39) missense possibly damaging 0.74
R7255:Plxna2 UTSW 1 194,434,411 (GRCm39) missense probably benign 0.03
R7283:Plxna2 UTSW 1 194,327,191 (GRCm39) missense probably damaging 0.99
R7288:Plxna2 UTSW 1 194,479,227 (GRCm39) missense probably damaging 1.00
R7361:Plxna2 UTSW 1 194,482,087 (GRCm39) missense probably damaging 1.00
R7424:Plxna2 UTSW 1 194,488,647 (GRCm39) missense probably damaging 0.98
R7501:Plxna2 UTSW 1 194,326,203 (GRCm39) missense possibly damaging 0.95
R7528:Plxna2 UTSW 1 194,494,464 (GRCm39) missense probably damaging 1.00
R7529:Plxna2 UTSW 1 194,326,179 (GRCm39) missense probably benign 0.25
R7532:Plxna2 UTSW 1 194,327,127 (GRCm39) missense probably benign 0.13
R7959:Plxna2 UTSW 1 194,493,270 (GRCm39) missense probably damaging 1.00
R7959:Plxna2 UTSW 1 194,476,172 (GRCm39) frame shift probably null
R7960:Plxna2 UTSW 1 194,476,172 (GRCm39) frame shift probably null
R8261:Plxna2 UTSW 1 194,431,724 (GRCm39) missense probably damaging 1.00
R8301:Plxna2 UTSW 1 194,472,483 (GRCm39) missense probably benign 0.01
R8463:Plxna2 UTSW 1 194,326,354 (GRCm39) missense probably damaging 1.00
R8519:Plxna2 UTSW 1 194,476,266 (GRCm39) missense probably damaging 1.00
R8836:Plxna2 UTSW 1 194,479,243 (GRCm39) missense possibly damaging 0.94
R9010:Plxna2 UTSW 1 194,471,217 (GRCm39) missense possibly damaging 0.95
R9034:Plxna2 UTSW 1 194,476,197 (GRCm39) missense probably damaging 1.00
R9254:Plxna2 UTSW 1 194,492,474 (GRCm39) missense probably damaging 1.00
R9274:Plxna2 UTSW 1 194,471,136 (GRCm39) missense probably damaging 1.00
R9379:Plxna2 UTSW 1 194,492,474 (GRCm39) missense probably damaging 1.00
R9385:Plxna2 UTSW 1 194,431,724 (GRCm39) missense possibly damaging 0.95
R9422:Plxna2 UTSW 1 194,326,730 (GRCm39) missense probably damaging 1.00
R9451:Plxna2 UTSW 1 194,326,692 (GRCm39) missense probably benign 0.05
R9484:Plxna2 UTSW 1 194,327,202 (GRCm39) missense probably damaging 1.00
X0027:Plxna2 UTSW 1 194,326,741 (GRCm39) missense probably damaging 1.00
Z1088:Plxna2 UTSW 1 194,446,847 (GRCm39) missense probably benign 0.06
Z1088:Plxna2 UTSW 1 194,326,749 (GRCm39) missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- GAGCTGTCCTTCTTAAGTACCC -3'
(R):5'- AAAGAAGTTTGCTCTGTGCTC -3'

Sequencing Primer
(F):5'- AACCAGCATCTTGGCTTGG -3'
(R):5'- TCTGTGCTCCGGTCGGTC -3'
Posted On 2015-04-29