Mutagenetix > Incidental Mutation

Incidental Mutation 'R3964:Upf1'

312253

Institutional Source

Beutler Lab

Gene Symbol

Upf1

Ensembl Gene

ENSMUSG00000058301

Gene Name

UPF1 regulator of nonsense transcripts homolog (yeast)

Synonyms

B430202H16Rik, PNORF-1, Rent1

MMRRC Submission

040933-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.970) question?

Stock #

R3964 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

70331525-70353278 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 70338460 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 544 (R544H)

Ref Sequence

ENSEMBL: ENSMUSP00000148927 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075666] [ENSMUST00000215817]

AlphaFold

Q9EPU0

Predicted Effect

probably damaging
Transcript: ENSMUST00000075666
AA Change: R555H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000075089
Gene: ENSMUSG00000058301
AA Change: R555H

Domain	Start	End	E-Value	Type
low complexity region	47	67	N/A	INTRINSIC
low complexity region	101	110	N/A	INTRINSIC
Pfam:UPF1_Zn_bind	116	267	4.1e-78	PFAM
Pfam:ResIII	475	617	1.3e-6	PFAM
Pfam:AAA_11	476	600	4.5e-24	PFAM
Pfam:AAA_30	476	688	5.6e-13	PFAM
Pfam:AAA_19	483	559	3.8e-16	PFAM
Pfam:AAA_11	576	679	7.7e-30	PFAM
Pfam:AAA_12	686	883	3.3e-64	PFAM
low complexity region	995	1001	N/A	INTRINSIC
low complexity region	1013	1028	N/A	INTRINSIC
low complexity region	1066	1081	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000215817
AA Change: R544H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.8963

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.3%

Validation Efficiency

98% (64/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is part of a post-splicing multiprotein complex involved in both mRNA nuclear export and mRNA surveillance. mRNA surveillance detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD). When translation ends upstream from the last exon-exon junction, this triggers NMD to degrade mRNAs containing premature stop codons. This protein is located only in the cytoplasm. When translation ends, it interacts with the protein that is a functional homolog of yeast Upf2p to trigger mRNA decapping. Use of multiple polyadenylation sites has been noted for this gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable in the pre-implantation period but resorb in the early post-implantation period. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A530099J19Rik	A	G	13: 19,729,444		noncoding transcript	Het
Adam21	C	A	12: 81,560,809	A60S	possibly damaging	Het
Arpp21	C	G	9: 112,065,776	V805L	probably damaging	Het
C1galt1c1	A	T	X: 38,631,576	V181E	probably benign	Het
Cdh18	A	T	15: 23,474,101	T686S	probably benign	Het
Cemip	T	A	7: 83,951,509	Y968F	probably benign	Het
Cep70	T	A	9: 99,298,534	F581I	probably damaging	Het
Ctc1	T	A	11: 69,031,128	V800D	probably damaging	Het
Cttnbp2nl	T	C	3: 105,006,005	K188E	probably damaging	Het
Cux1	A	G	5: 136,282,942	V1180A	probably damaging	Het
Cux2	G	T	5: 121,887,476	S43*	probably null	Het
Dhx57	T	A	17: 80,265,112	K711*	probably null	Het
Ehbp1l1	C	T	19: 5,710,573		probably null	Het
Esyt3	T	A	9: 99,320,322	D512V	probably damaging	Het
Fam35a	T	A	14: 34,259,687	Q498L	probably damaging	Het
Gadl1	T	C	9: 115,965,608	S284P	probably damaging	Het
Gm12169	T	A	11: 46,535,513	V149D	possibly damaging	Het
Gm14137	T	A	2: 119,175,016	S19T	probably benign	Het
Gprc6a	CAAA	CA	10: 51,615,680		probably null	Het
Gsdmc2	A	G	15: 63,849,834		probably benign	Het
Hmcn1	T	C	1: 150,573,569	T110A	probably benign	Het
Il23r	G	A	6: 67,466,297	T274I	probably benign	Het
Inhbb	C	A	1: 119,417,561	G333W	probably damaging	Het
Kcnb1	C	T	2: 167,104,492	C812Y	probably damaging	Het
Lrp1b	A	G	2: 41,312,470		probably benign	Het
Med31	C	T	11: 72,211,929	A118T	probably benign	Het
Mov10l1	A	G	15: 89,012,163	I737V	probably benign	Het
Mrs2	A	G	13: 25,001,763	I142T	possibly damaging	Het
Ms4a6b	T	C	19: 11,521,734	S71P	probably benign	Het
Muc2	G	A	7: 141,699,664	R120H	probably benign	Het
Muc5b	A	T	7: 141,866,968	I4191F	possibly damaging	Het
Myrf	T	C	19: 10,219,615	E267G	probably benign	Het
Nfatc2	C	T	2: 168,504,549	S875N	probably benign	Het
Nmi	T	C	2: 51,956,069	E67G	possibly damaging	Het
Nrap	T	C	19: 56,342,144	S1126G	probably damaging	Het
Nucb2	A	G	7: 116,528,875	E273G	probably damaging	Het
Olfr350	A	G	2: 36,850,717	T224A	probably benign	Het
Olfr904	T	C	9: 38,464,683	I214T	probably benign	Het
Olfr916	G	A	9: 38,657,727	L222F	probably benign	Het
Olfr979	A	T	9: 40,000,471	V252E	possibly damaging	Het
Pcdhga12	A	T	18: 37,767,201	Q362L	probably benign	Het
Peak1	C	T	9: 56,259,979	E222K	probably damaging	Het
Pik3r1	T	C	13: 101,688,685	E458G	possibly damaging	Het
Pls1	T	C	9: 95,785,612	Q81R	probably benign	Het
Plxdc2	T	A	2: 16,660,840	F284I	probably damaging	Het
Plxna2	C	T	1: 194,749,317	S538F	probably damaging	Het
Pole	A	G	5: 110,312,782	K1143E	probably damaging	Het
Ppfia4	A	T	1: 134,323,016	D478E	probably benign	Het
Ptprd	A	G	4: 76,059,836		probably benign	Het
Ptprj	A	G	2: 90,468,441	I315T	probably benign	Het
Rims1	T	C	1: 22,427,459		probably null	Het
Rnf13	G	A	3: 57,769,112	G63S	probably damaging	Het
Rsf1	GCG	GCGACGGCGACG	7: 97,579,907		probably benign	Het
Slc50a1	T	C	3: 89,268,786	I151V	probably benign	Het
Snx27	T	A	3: 94,531,306	R207S	probably damaging	Het
Sos1	C	T	17: 80,455,179	R73H	probably damaging	Het
Tbc1d9b	A	G	11: 50,168,696	E975G	possibly damaging	Het
Tbccd1	A	G	16: 22,841,773	S98P	probably damaging	Het
Tmx4	T	C	2: 134,600,061	I206V	possibly damaging	Het
Usp19	T	A	9: 108,498,029	V818E	probably damaging	Het
Wdr38	A	G	2: 38,999,350	Y51C	probably damaging	Het
Zfp456	T	C	13: 67,366,781	T269A	probably benign	Het
Zfp628	T	C	7: 4,921,745	S989P	probably benign	Het

Other mutations in Upf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01113:Upf1	APN	8	70338284	missense	probably benign
IGL01890:Upf1	APN	8	70334230	missense	possibly damaging	0.94
IGL02534:Upf1	APN	8	70335652	critical splice donor site	probably null
IGL03142:Upf1	APN	8	70333327	missense	probably benign	0.04
IGL03151:Upf1	APN	8	70335387	missense	probably damaging	0.98
Nanosphere	UTSW	8	70344262	missense	probably benign	0.01
Particulate	UTSW	8	70337025	missense	probably damaging	0.96
R0270:Upf1	UTSW	8	70335645	splice site	probably benign
R0477:Upf1	UTSW	8	70334080	missense	probably benign
R0755:Upf1	UTSW	8	70334129	missense	probably benign	0.01
R1018:Upf1	UTSW	8	70338906	missense	possibly damaging	0.85
R1067:Upf1	UTSW	8	70338403	missense	probably damaging	0.98
R1445:Upf1	UTSW	8	70341524	missense	probably benign	0.00
R1458:Upf1	UTSW	8	70344254	missense	probably benign	0.00
R1511:Upf1	UTSW	8	70338505	missense	probably damaging	0.99
R1552:Upf1	UTSW	8	70333059	nonsense	probably null
R1560:Upf1	UTSW	8	70338442	missense	probably damaging	1.00
R1562:Upf1	UTSW	8	70343367	nonsense	probably null
R2082:Upf1	UTSW	8	70341572	missense	probably damaging	1.00
R2143:Upf1	UTSW	8	70339354	missense	probably null	1.00
R2423:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R2425:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3031:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3032:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3123:Upf1	UTSW	8	70337483	splice site	probably benign
R3508:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3747:Upf1	UTSW	8	70333350	missense	possibly damaging	0.75
R3748:Upf1	UTSW	8	70333350	missense	possibly damaging	0.75
R3750:Upf1	UTSW	8	70333350	missense	possibly damaging	0.75
R3754:Upf1	UTSW	8	70339814	missense	probably benign	0.30
R3965:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R4152:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R4505:Upf1	UTSW	8	70337566	missense	probably damaging	1.00
R4506:Upf1	UTSW	8	70337566	missense	probably damaging	1.00
R4838:Upf1	UTSW	8	70339368	missense	probably benign	0.03
R5001:Upf1	UTSW	8	70334700	missense	probably damaging	1.00
R5715:Upf1	UTSW	8	70352978	missense	probably damaging	0.96
R5748:Upf1	UTSW	8	70338517	missense	probably damaging	1.00
R5856:Upf1	UTSW	8	70334762	critical splice acceptor site	probably null
R5930:Upf1	UTSW	8	70344262	missense	probably benign	0.01
R6010:Upf1	UTSW	8	70337025	missense	probably damaging	0.96
R6056:Upf1	UTSW	8	70333037	missense	probably damaging	0.98
R6870:Upf1	UTSW	8	70341561	missense	probably benign	0.11
R7205:Upf1	UTSW	8	70340045	missense	possibly damaging	0.94
R7385:Upf1	UTSW	8	70340618	missense	probably damaging	1.00
R7464:Upf1	UTSW	8	70333423	missense	probably benign
R7759:Upf1	UTSW	8	70334080	missense	probably benign
R7783:Upf1	UTSW	8	70352858	missense	probably benign	0.11
R8079:Upf1	UTSW	8	70338884	critical splice donor site	probably null
R8192:Upf1	UTSW	8	70340644	missense	probably benign	0.03
R8544:Upf1	UTSW	8	70337052	missense	probably damaging	1.00
R8738:Upf1	UTSW	8	70333322	missense	probably benign	0.01
R8738:Upf1	UTSW	8	70333323	missense	probably benign	0.06
R8826:Upf1	UTSW	8	70338280	missense	probably benign
R8876:Upf1	UTSW	8	70344268	missense	possibly damaging	0.92
R8906:Upf1	UTSW	8	70334165	nonsense	probably null
R8911:Upf1	UTSW	8	70338437	missense	possibly damaging	0.53
R9163:Upf1	UTSW	8	70340024	missense	probably benign
R9425:Upf1	UTSW	8	70339353	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- TCATCCTTTAGCTGCTGCAG -3'
(R):5'- ACAGGAGGCTTTGCTTGTTC -3'

Sequencing Primer
(F):5'- GCTTCTGCAGCTCAGGCATG -3'
(R):5'- TGCCTATTACAGCTGTGCAG -3'

Posted On

2015-04-29