Incidental Mutation 'R3964:Peak1'
ID312257
Institutional Source Beutler Lab
Gene Symbol Peak1
Ensembl Gene ENSMUSG00000074305
Gene Namepseudopodium-enriched atypical kinase 1
SynonymsC230081A13Rik, NKF3 kinase family member, 1110049L02Rik
MMRRC Submission 040933-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.396) question?
Stock #R3964 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location56201126-56418067 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 56259979 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 222 (E222K)
Ref Sequence ENSEMBL: ENSMUSP00000109901 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061552] [ENSMUST00000186735]
Predicted Effect probably damaging
Transcript: ENSMUST00000061552
AA Change: E222K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109901
Gene: ENSMUSG00000074305
AA Change: E222K

DomainStartEndE-ValueType
low complexity region 247 259 N/A INTRINSIC
low complexity region 325 336 N/A INTRINSIC
low complexity region 367 378 N/A INTRINSIC
low complexity region 498 509 N/A INTRINSIC
low complexity region 845 856 N/A INTRINSIC
low complexity region 860 878 N/A INTRINSIC
low complexity region 932 948 N/A INTRINSIC
Pfam:Pkinase_Tyr 1437 1649 1.5e-6 PFAM
Pfam:Pkinase 1440 1651 2.3e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181444
Predicted Effect probably benign
Transcript: ENSMUST00000186735
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192330
Meta Mutation Damage Score 0.1695 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a non-receptor tyrosine kinase that is a member of the new kinase family three (NFK3) family. In migrating cells, the encoded protein is associated with the actin cytoskeleton and focal adhesions and promotes developing focal adhesion elongation. This protein may play a role in the regulation of cell migration, proliferation and cancer metastasis. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530099J19Rik A G 13: 19,729,444 noncoding transcript Het
Adam21 C A 12: 81,560,809 A60S possibly damaging Het
Arpp21 C G 9: 112,065,776 V805L probably damaging Het
C1galt1c1 A T X: 38,631,576 V181E probably benign Het
Cdh18 A T 15: 23,474,101 T686S probably benign Het
Cemip T A 7: 83,951,509 Y968F probably benign Het
Cep70 T A 9: 99,298,534 F581I probably damaging Het
Ctc1 T A 11: 69,031,128 V800D probably damaging Het
Cttnbp2nl T C 3: 105,006,005 K188E probably damaging Het
Cux1 A G 5: 136,282,942 V1180A probably damaging Het
Cux2 G T 5: 121,887,476 S43* probably null Het
Dhx57 T A 17: 80,265,112 K711* probably null Het
Ehbp1l1 C T 19: 5,710,573 probably null Het
Esyt3 T A 9: 99,320,322 D512V probably damaging Het
Fam35a T A 14: 34,259,687 Q498L probably damaging Het
Gadl1 T C 9: 115,965,608 S284P probably damaging Het
Gm12169 T A 11: 46,535,513 V149D possibly damaging Het
Gm14137 T A 2: 119,175,016 S19T probably benign Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Gsdmc2 A G 15: 63,849,834 probably benign Het
Hmcn1 T C 1: 150,573,569 T110A probably benign Het
Il23r G A 6: 67,466,297 T274I probably benign Het
Inhbb C A 1: 119,417,561 G333W probably damaging Het
Kcnb1 C T 2: 167,104,492 C812Y probably damaging Het
Lrp1b A G 2: 41,312,470 probably benign Het
Med31 C T 11: 72,211,929 A118T probably benign Het
Mov10l1 A G 15: 89,012,163 I737V probably benign Het
Mrs2 A G 13: 25,001,763 I142T possibly damaging Het
Ms4a6b T C 19: 11,521,734 S71P probably benign Het
Muc2 G A 7: 141,699,664 R120H probably benign Het
Muc5b A T 7: 141,866,968 I4191F possibly damaging Het
Myrf T C 19: 10,219,615 E267G probably benign Het
Nfatc2 C T 2: 168,504,549 S875N probably benign Het
Nmi T C 2: 51,956,069 E67G possibly damaging Het
Nrap T C 19: 56,342,144 S1126G probably damaging Het
Nucb2 A G 7: 116,528,875 E273G probably damaging Het
Olfr350 A G 2: 36,850,717 T224A probably benign Het
Olfr904 T C 9: 38,464,683 I214T probably benign Het
Olfr916 G A 9: 38,657,727 L222F probably benign Het
Olfr979 A T 9: 40,000,471 V252E possibly damaging Het
Pcdhga12 A T 18: 37,767,201 Q362L probably benign Het
Pik3r1 T C 13: 101,688,685 E458G possibly damaging Het
Pls1 T C 9: 95,785,612 Q81R probably benign Het
Plxdc2 T A 2: 16,660,840 F284I probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Pole A G 5: 110,312,782 K1143E probably damaging Het
Ppfia4 A T 1: 134,323,016 D478E probably benign Het
Ptprd A G 4: 76,059,836 probably benign Het
Ptprj A G 2: 90,468,441 I315T probably benign Het
Rims1 T C 1: 22,427,459 probably null Het
Rnf13 G A 3: 57,769,112 G63S probably damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Slc50a1 T C 3: 89,268,786 I151V probably benign Het
Snx27 T A 3: 94,531,306 R207S probably damaging Het
Sos1 C T 17: 80,455,179 R73H probably damaging Het
Tbc1d9b A G 11: 50,168,696 E975G possibly damaging Het
Tbccd1 A G 16: 22,841,773 S98P probably damaging Het
Tmx4 T C 2: 134,600,061 I206V possibly damaging Het
Upf1 C T 8: 70,338,460 R544H probably damaging Het
Usp19 T A 9: 108,498,029 V818E probably damaging Het
Wdr38 A G 2: 38,999,350 Y51C probably damaging Het
Zfp456 T C 13: 67,366,781 T269A probably benign Het
Zfp628 T C 7: 4,921,745 S989P probably benign Het
Other mutations in Peak1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Peak1 APN 9 56227326 missense probably damaging 1.00
IGL00544:Peak1 APN 9 56259978 missense probably damaging 1.00
IGL01141:Peak1 APN 9 56258527 missense probably benign 0.01
IGL01743:Peak1 APN 9 56259202 missense probably damaging 1.00
IGL01781:Peak1 APN 9 56260065 missense possibly damaging 0.92
IGL01885:Peak1 APN 9 56260104 missense probably damaging 1.00
IGL01941:Peak1 APN 9 56258775 missense probably damaging 1.00
IGL02455:Peak1 APN 9 56227473 missense possibly damaging 0.89
IGL02719:Peak1 APN 9 56227206 missense probably damaging 1.00
IGL03247:Peak1 APN 9 56257930 missense probably damaging 1.00
IGL03259:Peak1 APN 9 56259967 missense probably damaging 1.00
R0060:Peak1 UTSW 9 56227823 missense probably damaging 1.00
R0087:Peak1 UTSW 9 56258325 missense probably damaging 1.00
R0480:Peak1 UTSW 9 56258632 missense probably benign 0.00
R0569:Peak1 UTSW 9 56260089 missense probably damaging 1.00
R0605:Peak1 UTSW 9 56227098 splice site probably benign
R0865:Peak1 UTSW 9 56257832 missense probably benign 0.02
R1117:Peak1 UTSW 9 56258418 missense probably benign 0.05
R1922:Peak1 UTSW 9 56206687 missense probably damaging 1.00
R1959:Peak1 UTSW 9 56206789 missense probably damaging 1.00
R2069:Peak1 UTSW 9 56258759 missense probably damaging 1.00
R2083:Peak1 UTSW 9 56258949 missense probably damaging 1.00
R2154:Peak1 UTSW 9 56207212 missense probably damaging 1.00
R2407:Peak1 UTSW 9 56259226 missense probably damaging 1.00
R3832:Peak1 UTSW 9 56258383 missense probably benign
R3938:Peak1 UTSW 9 56260365 missense probably benign 0.01
R4192:Peak1 UTSW 9 56258741 missense probably damaging 1.00
R4381:Peak1 UTSW 9 56258427 missense probably benign 0.34
R4869:Peak1 UTSW 9 56227592 missense probably benign 0.06
R4994:Peak1 UTSW 9 56241276 missense possibly damaging 0.65
R5062:Peak1 UTSW 9 56260289 missense probably damaging 1.00
R5435:Peak1 UTSW 9 56206486 missense probably damaging 0.98
R5632:Peak1 UTSW 9 56257774 missense probably damaging 1.00
R5643:Peak1 UTSW 9 56258755 missense probably damaging 0.99
R5880:Peak1 UTSW 9 56207610 missense probably damaging 1.00
R5898:Peak1 UTSW 9 56207338 missense probably benign 0.19
R5986:Peak1 UTSW 9 56259442 missense probably benign 0.00
R6109:Peak1 UTSW 9 56259283 missense probably benign 0.01
R6284:Peak1 UTSW 9 56260296 missense probably benign 0.10
R6347:Peak1 UTSW 9 56258211 missense probably benign 0.00
R6374:Peak1 UTSW 9 56257666 missense probably damaging 1.00
R6471:Peak1 UTSW 9 56258259 missense probably damaging 1.00
R6717:Peak1 UTSW 9 56207239 missense probably benign 0.00
R7033:Peak1 UTSW 9 56259707 missense probably damaging 1.00
R7039:Peak1 UTSW 9 56257809 missense probably benign 0.01
R7100:Peak1 UTSW 9 56259393 missense probably damaging 1.00
R7604:Peak1 UTSW 9 56241207 nonsense probably null
R7868:Peak1 UTSW 9 56260470 missense probably damaging 1.00
R7951:Peak1 UTSW 9 56260470 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTTGCCCTGAAGTTAGCAAAG -3'
(R):5'- CAACAACGGGCTAACTGAAGTG -3'

Sequencing Primer
(F):5'- TTAGCAAAGCGAGGCTGCC -3'
(R):5'- CGGGCTAACTGAAGTGCTAAAG -3'
Posted On2015-04-29