Incidental Mutation 'R3964:Cdh18'
ID312276
Institutional Source Beutler Lab
Gene Symbol Cdh18
Ensembl Gene ENSMUSG00000040420
Gene Namecadherin 18
Synonyms
MMRRC Submission 040933-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R3964 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location22549022-23474418 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 23474101 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 686 (T686S)
Ref Sequence ENSEMBL: ENSMUSP00000130851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164787] [ENSMUST00000165614] [ENSMUST00000167623] [ENSMUST00000226693]
Predicted Effect probably benign
Transcript: ENSMUST00000164787
AA Change: T686S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000130851
Gene: ENSMUSG00000040420
AA Change: T686S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
CA 76 157 4.24e-14 SMART
CA 181 266 1.37e-31 SMART
CA 290 382 2.76e-13 SMART
CA 405 486 3.86e-26 SMART
CA 509 596 3.7e-5 SMART
transmembrane domain 614 636 N/A INTRINSIC
Pfam:Cadherin_C 639 783 6.8e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165614
SMART Domains Protein: ENSMUSP00000128643
Gene: ENSMUSG00000040420

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
CA 76 157 4.24e-14 SMART
CA 181 266 1.37e-31 SMART
CA 290 382 2.76e-13 SMART
CA 405 486 3.86e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167623
SMART Domains Protein: ENSMUSP00000128011
Gene: ENSMUSG00000040420

DomainStartEndE-ValueType
CA 22 103 4.24e-14 SMART
CA 127 212 1.37e-31 SMART
CA 236 328 2.76e-13 SMART
CA 351 414 4.15e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226693
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type II classical cadherin from the cadherin superfamily of integral membrane proteins that mediate calcium-dependent cell-cell adhesion. Mature cadherin proteins are composed of a large N-terminal extracellular domain, a single membrane-spanning domain, and a small, highly conserved C-terminal cytoplasmic domain. Type II (atypical) cadherins are defined based on their lack of a HAV cell adhesion recognition sequence specific to type I cadherins. This particular cadherin is expressed specifically in the central nervous system and is putatively involved in synaptic adhesion, axon outgrowth and guidance. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2014]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530099J19Rik A G 13: 19,729,444 noncoding transcript Het
Adam21 C A 12: 81,560,809 A60S possibly damaging Het
Arpp21 C G 9: 112,065,776 V805L probably damaging Het
C1galt1c1 A T X: 38,631,576 V181E probably benign Het
Cemip T A 7: 83,951,509 Y968F probably benign Het
Cep70 T A 9: 99,298,534 F581I probably damaging Het
Ctc1 T A 11: 69,031,128 V800D probably damaging Het
Cttnbp2nl T C 3: 105,006,005 K188E probably damaging Het
Cux1 A G 5: 136,282,942 V1180A probably damaging Het
Cux2 G T 5: 121,887,476 S43* probably null Het
Dhx57 T A 17: 80,265,112 K711* probably null Het
Ehbp1l1 C T 19: 5,710,573 probably null Het
Esyt3 T A 9: 99,320,322 D512V probably damaging Het
Fam35a T A 14: 34,259,687 Q498L probably damaging Het
Gadl1 T C 9: 115,965,608 S284P probably damaging Het
Gm12169 T A 11: 46,535,513 V149D possibly damaging Het
Gm14137 T A 2: 119,175,016 S19T probably benign Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Gsdmc2 A G 15: 63,849,834 probably benign Het
Hmcn1 T C 1: 150,573,569 T110A probably benign Het
Il23r G A 6: 67,466,297 T274I probably benign Het
Inhbb C A 1: 119,417,561 G333W probably damaging Het
Kcnb1 C T 2: 167,104,492 C812Y probably damaging Het
Lrp1b A G 2: 41,312,470 probably benign Het
Med31 C T 11: 72,211,929 A118T probably benign Het
Mov10l1 A G 15: 89,012,163 I737V probably benign Het
Mrs2 A G 13: 25,001,763 I142T possibly damaging Het
Ms4a6b T C 19: 11,521,734 S71P probably benign Het
Muc2 G A 7: 141,699,664 R120H probably benign Het
Muc5b A T 7: 141,866,968 I4191F possibly damaging Het
Myrf T C 19: 10,219,615 E267G probably benign Het
Nfatc2 C T 2: 168,504,549 S875N probably benign Het
Nmi T C 2: 51,956,069 E67G possibly damaging Het
Nrap T C 19: 56,342,144 S1126G probably damaging Het
Nucb2 A G 7: 116,528,875 E273G probably damaging Het
Olfr350 A G 2: 36,850,717 T224A probably benign Het
Olfr904 T C 9: 38,464,683 I214T probably benign Het
Olfr916 G A 9: 38,657,727 L222F probably benign Het
Olfr979 A T 9: 40,000,471 V252E possibly damaging Het
Pcdhga12 A T 18: 37,767,201 Q362L probably benign Het
Peak1 C T 9: 56,259,979 E222K probably damaging Het
Pik3r1 T C 13: 101,688,685 E458G possibly damaging Het
Pls1 T C 9: 95,785,612 Q81R probably benign Het
Plxdc2 T A 2: 16,660,840 F284I probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Pole A G 5: 110,312,782 K1143E probably damaging Het
Ppfia4 A T 1: 134,323,016 D478E probably benign Het
Ptprd A G 4: 76,059,836 probably benign Het
Ptprj A G 2: 90,468,441 I315T probably benign Het
Rims1 T C 1: 22,427,459 probably null Het
Rnf13 G A 3: 57,769,112 G63S probably damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Slc50a1 T C 3: 89,268,786 I151V probably benign Het
Snx27 T A 3: 94,531,306 R207S probably damaging Het
Sos1 C T 17: 80,455,179 R73H probably damaging Het
Tbc1d9b A G 11: 50,168,696 E975G possibly damaging Het
Tbccd1 A G 16: 22,841,773 S98P probably damaging Het
Tmx4 T C 2: 134,600,061 I206V possibly damaging Het
Upf1 C T 8: 70,338,460 R544H probably damaging Het
Usp19 T A 9: 108,498,029 V818E probably damaging Het
Wdr38 A G 2: 38,999,350 Y51C probably damaging Het
Zfp456 T C 13: 67,366,781 T269A probably benign Het
Zfp628 T C 7: 4,921,745 S989P probably benign Het
Other mutations in Cdh18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Cdh18 APN 15 23173796 missense probably damaging 0.97
IGL01663:Cdh18 APN 15 23445991 missense possibly damaging 0.92
IGL01758:Cdh18 APN 15 23474183 missense probably benign 0.20
IGL02192:Cdh18 APN 15 23460316 missense probably damaging 1.00
IGL02448:Cdh18 APN 15 23173789 missense probably benign 0.00
IGL02717:Cdh18 APN 15 23410715 nonsense probably null
IGL03241:Cdh18 APN 15 23226933 missense probably benign 0.19
IGL03268:Cdh18 APN 15 23366867 missense probably damaging 1.00
IGL03307:Cdh18 APN 15 23226786 missense probably damaging 1.00
R0316:Cdh18 UTSW 15 23366913 missense probably damaging 1.00
R0462:Cdh18 UTSW 15 23366885 missense probably damaging 1.00
R0607:Cdh18 UTSW 15 23410790 missense probably benign 0.01
R0761:Cdh18 UTSW 15 23226752 missense possibly damaging 0.87
R0973:Cdh18 UTSW 15 23473995 missense probably damaging 0.99
R1110:Cdh18 UTSW 15 23474317 missense probably benign 0.00
R1550:Cdh18 UTSW 15 23436548 missense probably damaging 1.00
R1656:Cdh18 UTSW 15 23474399 missense probably benign 0.38
R1682:Cdh18 UTSW 15 23400585 missense probably benign 0.05
R1770:Cdh18 UTSW 15 23474401 missense probably benign
R1829:Cdh18 UTSW 15 23173852 missense probably damaging 1.00
R2253:Cdh18 UTSW 15 23410805 missense probably benign 0.00
R2435:Cdh18 UTSW 15 23367008 missense probably damaging 1.00
R3914:Cdh18 UTSW 15 23410685 missense probably damaging 1.00
R4002:Cdh18 UTSW 15 23382962 missense possibly damaging 0.48
R4291:Cdh18 UTSW 15 22714551 intron probably benign
R4581:Cdh18 UTSW 15 23226783 missense probably damaging 1.00
R4604:Cdh18 UTSW 15 23474368 missense probably benign 0.05
R4625:Cdh18 UTSW 15 22714042 intron probably benign
R4786:Cdh18 UTSW 15 23410787 missense probably null 1.00
R4811:Cdh18 UTSW 15 23226791 missense probably benign 0.30
R5023:Cdh18 UTSW 15 23259666 missense probably damaging 1.00
R5094:Cdh18 UTSW 15 22714539 intron probably benign
R5278:Cdh18 UTSW 15 23474158 missense probably benign 0.04
R5416:Cdh18 UTSW 15 23226723 missense probably damaging 1.00
R5503:Cdh18 UTSW 15 23436534 missense probably damaging 0.96
R5617:Cdh18 UTSW 15 23226768 missense probably damaging 0.97
R5982:Cdh18 UTSW 15 23474216 missense possibly damaging 0.89
R6240:Cdh18 UTSW 15 23226936 missense possibly damaging 0.82
R6475:Cdh18 UTSW 15 23226936 missense possibly damaging 0.82
R6649:Cdh18 UTSW 15 23436534 missense possibly damaging 0.87
R6700:Cdh18 UTSW 15 23474105 missense probably benign
R6718:Cdh18 UTSW 15 23226749 missense probably benign 0.15
R6796:Cdh18 UTSW 15 23446073 missense probably damaging 1.00
R7330:Cdh18 UTSW 15 23226950 missense possibly damaging 0.46
R7429:Cdh18 UTSW 15 23366856 missense possibly damaging 0.89
R7477:Cdh18 UTSW 15 23410725 missense probably benign
R7516:Cdh18 UTSW 15 23259598 splice site probably null
R7519:Cdh18 UTSW 15 23474212 missense possibly damaging 0.68
R7575:Cdh18 UTSW 15 23400597 nonsense probably null
R7618:Cdh18 UTSW 15 23366970 missense probably damaging 1.00
R7844:Cdh18 UTSW 15 23410787 missense probably damaging 1.00
R7870:Cdh18 UTSW 15 23474327 missense possibly damaging 0.94
R8288:Cdh18 UTSW 15 23445987 missense probably damaging 1.00
R8420:Cdh18 UTSW 15 23474052 missense possibly damaging 0.94
R8430:Cdh18 UTSW 15 23226684 missense probably damaging 1.00
R8916:Cdh18 UTSW 15 23410727 missense probably damaging 0.99
Z1189:Cdh18 UTSW 15 23474283 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- AGCCAAAGCCTAAGTCCTTC -3'
(R):5'- CCCTCGTAGGCATAAGTCTG -3'

Sequencing Primer
(F):5'- AAAGCCTAAGTCCTTCTCTCTG -3'
(R):5'- CCCTCGTAGGCATAAGTCTGAAGAG -3'
Posted On2015-04-29